Información

¿Cuánta variación hay entre las moléculas de ADN del mismo organismo?

¿Cuánta variación hay entre las moléculas de ADN del mismo organismo?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Si se extrajeran de mi cuerpo moléculas de ADN diferentes pero intactas, por ejemplo, una muestra de cabello, una muestra de sangre y un hisopo bucal, ¿cuánta variación habría entre las moléculas de ADN?


El fenómeno se llama variaciones en mosaico de un solo nucleótido (SNV) en células somáticas y es un área activa de investigación científica (por ejemplo, Abyzov et al., 2017, Genome Res.27: 512-523):

Estimamos que, en promedio, una célula de fibroblastos en niños tiene 1035 en su mayoría SNV en mosaico benignos.

Análisis similares en adultos no revelaron un aumento significativo en el número de SNV por célula, lo que sugiere que una fracción importante de SNV en mosaico en los fibroblastos surge durante el desarrollo.


Hay varias respuestas a esta pregunta, dependiendo exactamente de lo que quiera decir.

Las células del cuerpo acumularán mutaciones aleatorias a medida que se dividen y se multiplican.

Las células del cuerpo que no forman parte de la línea reproductiva se denominan "células somáticas". Por lo general, estas células se derivan de un solo óvulo fertilizado. Cada vez que la célula se divide, el ADN debe duplicarse y cada vez que se duplica existe la posibilidad de que se produzca una mutación aleatoria. Estas mutaciones aleatorias se transmitirán a cualquier célula que luego se derive de esta célula. La mayor parte del trabajo en esta área se basa en variaciones de un solo nucleótido (consulte la respuesta de Martin Klvana), pero también puede haber inserciones, deleciones y duplicaciones, como ocurre con otras mutaciones.

El daño por radiación y otros mutágenos puede causar mutaciones en el ADN

Las células están sujetas a daños durante toda su vida y algunas formas de daño provocan roturas o alteraciones en el ADN de la célula. Existen complejos mecanismos de reparación para hacer frente a este daño, pero son imperfectos, por lo que con el tiempo este daño puede resultar en diferencias en la secuencia de ADN de las células de su cuerpo. Esto aumentará con la edad.

Algunas células tienen mecanismos para una mutación aleatoria deliberada.

Ciertas células del cuerpo han evolucionado para ser aleatoriamente diferentes entre sí. El ejemplo más obvio de esto se encuentra en el sistema inmunológico, donde se utilizan reordenamientos aleatorios de secciones específicas de ADN para crear una amplia gama de anticuerpos diferentes.

Los elementos genéticos móviles pueden activarse y reorganizarse a través del cuerpo.

El genoma humano, como el de otros organismos, está lleno de transposones y otros elementos genéticos que contienen maquinaria genética para reubicarse dentro del genoma. La actividad de estos elementos en las células somáticas del cuerpo puede dar lugar a diferencias en la secuencia del ADN.

No todo el mundo tiene todas sus células de un solo óvulo fertilizado

Puede suceder que en lugar de derivar de un solo óvulo fertilizado, una persona se derive de dos o más óvulos fertilizados, de modo que su cuerpo esté formado por células de origen genético distinto que son efectivamente hermanos entre sí. Esto puede resultar en grandes diferencias genéticas entre células.

Además, en las mujeres que han tenido hijos, es común (se encuentra en alrededor del 50-75% de las mujeres) que algunas células del feto ingresen al cuerpo de la madre y se establezcan permanentemente en un fenómeno llamado microquimerismo feto-materno. Una vez más, esto puede dar lugar a grandes diferencias genéticas entre las células.

Las diferencias en el ADN van mucho más allá de las meras diferencias en la secuencia.

Todos los mecanismos que he discutido hasta ahora conducirán a diferencias en la secuencia de ADN, sin embargo, el ADN en una célula es más que un simple depósito de información de secuencia, y su función está mediada tanto por modificaciones químicas, sobre todo por metilación del ADN, como por interacción con proteínas, sobre todo a través de las histonas que median el plegamiento del ADN en la célula, o mediante la inactivación selectiva de un cromosoma X en el cuerpo de Barr si es mujer. Estas modificaciones tienen efectos profundos en la actividad del ADN dentro de la célula y no deben ignorarse.

Todo esto significa que no hay una respuesta única a su pregunta, ya que cambia con el tiempo, varía entre las personas y depende exactamente de lo que quiera decir.


La base de la variación hereditaria

Cómo se reproducen los organismos "según su propia especie" (para tomar prestado el lenguaje del Génesis) es una cuestión de larga data en biología. Una pregunta estrechamente relacionada surge de la observación de que dentro de un "tipo", no todos los individuos son iguales; existe variación dentro de las poblaciones de la misma especie. Durante muchos años, el mecanismo que podría explicar tanto el observadoconstancia de una especie (reproducción fiel de la forma de un organismo) y variación (no todos los miembros de una especie son idénticos) sigue siendo un misterio. Para arrojar algo de luz sobre estos temas importantes para la biología evolutiva, necesitamos tomarnos un tiempo para explorar los "aspectos prácticos" de cómo funcionan dos moléculas biológicas importantes y cómo se relacionan entre sí: ácido desoxirribonucleico (ADN) y proteínas.

Genética molecular 101: proteínas y ADN

Es posible que se sorprenda al saber que los primeros trabajos de exploración de la base molecular de la genética favorecieron a las proteínas como molécula hereditaria en lugar del ADN. Se sospechaba que cualquier cosa que actuara como molécula hereditaria sería grande y compleja, y las proteínas lo eran a la vez. Las proteínas pueden ser muy largas, ya que son un polímero de componentes repetidos más pequeños (monómeros). Podemos utilizar los ladrillos entrelazados de los niños para ilustrar lo que queremos decir. Para los ladrillos, cada pieza individual es una monómeroy cuando se unen, forman una polímero:

Las proteínas se construyen prácticamente de la misma manera. Para las proteínas, los monómeros son un grupo de compuestos llamados aminoácidos (cada aminoácido es un monómero). Al igual que los ladrillos de nuestra analogía, tienen características en común que les permiten "encajarlos" en una larga cadena. También tienen diferencias significativas, análogas a los diferentes colores en el diagrama: algunos aminoácidos son hidrófobos (es decir, son repelidos por el agua), otros son hidrófilos (es decir, atraídos por el agua). Algunos son grandes y voluminosos, otros son comparativamente pequeños, etc. A diferencia de los ladrillos rígidos en nuestra analogía, las proteínas son maravillosamente flexibles y se pliegan en una forma tridimensional, según lo indiquen las propiedades de los monómeros.

Hay 20 aminoácidos diferentes que se utilizan para producir proteínas, y se pueden combinar en cualquier secuencia para producir una proteína con propiedades específicas: propiedades que surgen de la combinación y el orden específico de los aminoácidos, y la forma final que dan. a la proteína. Esta diversidad de monómeros significa que hay muchas, muchas posibilidades diferentes para secuencias de proteínas (y por lo tanto formas y funciones); incluso un polímero de solo dos monómeros de longitud tiene 400 secuencias posibles (es decir, 202, o 20 & # 21520), y las proteínas pueden tener miles de aminoácidos de longitud. Fue esta posibilidad de complejidad a gran escala lo que sugirió que las proteínas podrían tener suficiente "capacidad de almacenamiento" para retener información hereditaria y transmitirla a la siguiente generación.

Sin embargo, a finales de la década de 1920, la investigación comenzó a alejarse de las proteínas y apuntar hacia el ADN como molécula hereditaria. El ADN, al igual que las proteínas, es un polímero formado a partir de un conjunto de monómeros (en este caso, ácidos nucleicos). En contraste con los 20 monómeros que se encuentran en las proteínas, el ADN tiene solo cuatro monómeros: compuestos abreviados como A, C, G y T. Fue por esta razón que los investigadores inicialmente se mostraron escépticos de que un polímero tan "simple" pudiera actuar como fuente de información hereditaria.

A pesar de este escepticismo, siguió aumentando la evidencia de que el ADN era de hecho la base física de la información hereditaria. Una vez que esta evidencia convenció a la mayoría de los científicos, comenzó la carrera para comprender exactamente cómo el ADN logró esta notable tarea. Pronto, quedó claro que comprender la estructura del ADN era crucial para comprender su función, y varios grupos de investigación compitieron por ser los primeros en descifrarlo.

La determinación de la estructura del ADN arrojó luz sobre su función. Aunque tiene solo cuatro monómeros, la estructura del ADN reveló cómo puede replicarse fácilmente y transmitir información: el ADN no solo es un polímero largo, es un polímero que puede especificar su propia replicación a través de interacciones entre sus monómeros. Quizás una imagen ayudaría a explicarlo. Imagínese ladrillos que ahora tienen "socios" que los atraen. Representaremos esa atracción, que es un tipo de enlace químico llamado enlace de hidrógeno, con un punto negro. Los monómeros "A" y "T" se atraen con dos enlaces de hidrógeno, y los monómeros "C" y "G" con tres:

Estos "emparejamientos de atracción" entre monómeros son importantes: permiten que un polímero de ADN actúe como plantilla para un segundo polímero de ADN "complementario". Imagina una secuencia de ADN de la siguiente manera:

A medida que se fabrica el segundo polímero de ADN, los monómeros se seleccionan, uno a la vez, para que coincidan con sus "socios" en el primer polímero:

Estos dos polímeros se mantienen unidos por la alineación de muchos enlaces de hidrógeno, y es probable que esté familiarizado con ellos como las "dos hebras" de la doble hélice del ADN:

Si bien este modelo más realista de ADN muestra los detalles precisos de su estructura molecular, las características importantes se resumen en nuestro modelo simple de "ladrillo de juguete". El ADN es un par de polímeros largos que se pueden separar y usar para hacer nuevas copias que son fieles al original.

Si bien estas características del ADN explican fácilmente cómo se copia fielmente, recuerde que también debemos explicar la variación. La variación, en los términos más básicos, significa que a veces hay imperfecciones en el proceso de copia. Si el ADN es de hecho la molécula hereditaria, y si la copia del ADN fuera 100% precisa, nunca surgiría variación y toda la descendencia sería genéticamente idéntica a sus padres. Sin variación, la recombinación no tendría ningún efecto (ya que no habría variación para mezclar en nuevas combinaciones).

Hay muchas formas en que la variación puede entrar durante el proceso de copia de ADN, y en una publicación futura examinaremos varias de ellas. Una forma que consideraremos ahora es un simple "emparejamiento incorrecto" de monómeros durante la replicación. A una cierta frecuencia (muy baja), los monómeros inapropiados se emparejan. La flecha en la figura siguiente muestra uno de esos pares no emparejados, donde un monómero rojo (G) en la hebra inferior se emparejó incorrectamente con un monómero amarillo (T) cuando se hizo la hebra superior. Cuando se replica este conjunto, se copian las cadenas superior e inferior, pero ahora se encuentran las parejas correctas para cada monómero. El resultado son dos resultados diferentes: una copia ahora tiene el par C: G original y correcto (a la izquierda), y la otra tiene una nueva variante, con un par A: T (a la derecha). Este cambio se copiará fielmente a partir de ahora, ya que las copias posteriores no "saben" cuál era la secuencia original. El resultado es una nueva variante en la población.

En conjunto, las propiedades del ADN coinciden con lo que observamos en la naturaleza: reproducción fiel de la forma, pero no reproducción perfecta de la forma. En su base, la constancia y la variación hereditaria en las poblaciones biológicas se remontan al funcionamiento del ADN.

¿Y las proteínas?

Si bien las propiedades del ADN lo convierten en una gran molécula hereditaria (que sin embargo permite que surja la variación), el ADN en sí mismo no es capaz de realizar las funciones diarias que los organismos necesitan (funciones enzimáticas, funciones estructurales, etc.). Para estas funciones, se requiere la gran diversidad estructural de proteínas. En la próxima publicación de esta serie, discutiremos cómo la información hereditaria en el ADN se transfiere a la estructura y función de las proteínas, y cómo la variación en el ADN puede causar variaciones a nivel de proteína.

Anteriormente, discutimos cómo la replicación del ADN se facilita fácilmente por su estructura, ya que la mitad de la doble hélice del ADN puede servir como plantilla para hacer la otra mitad. También discutimos cómo el ADN, aunque es adecuado para su función hereditaria, no lo es en absoluto para realizar funciones celulares, pero que las proteínas cumplen estas funciones. Con estos detalles cubiertos, ahora estamos listos para discutir cómo la información hereditaria en el ADN se convierte en la diversidad funcional que vemos en las proteínas, y cómo la variación juega un papel en este proceso. El primer paso de esta discusión requiere que analicemos cómo funcionan los cromosomas y los genes.

Genética molecular 102: Cromosomas y genes

Los seres humanos tienen 46 cromosomas en cada una de sus células y vienen en pares. Recibimos uno de cada par como un conjunto de 23 cromosomas de cada padre: los óvulos contienen 22 cromosomas no sexuales más un cromosoma X, y los espermatozoides contienen 22 cromosomas no sexuales más un cromosoma X o Y. Cada cromosoma es una doble hélice de ADN larga, con millones de pares de bases de ADN. Nuestros cromosomas más grandes tienen alrededor de 250 millones de pares de bases y los más pequeños alrededor de 50 millones. En conjunto, el genoma humano tiene alrededor de 3 mil millones de pares de bases de ADN en cada conjunto de 23 cromosomas, o un total de alrededor de 6 mil millones si se cuentan ambos conjuntos.

Distribuidos en estos 23 pares de cromosomas son genes—Las unidades de función biológica codificadas dentro de nuestro ADN. Lo que constituye exactamente un "gen", como todos los buenos conceptos en biología, es "difuso", pero para nuestros propósitos definiremos un gen como una secuencia de pares de bases de ADN de cromosomas que se utilizan para hacer un producto funcional que no es de ADN. Los seres humanos tienen alrededor de 20.000 genes y pueden estar bastante dispersos en los cromosomas, con una gran cantidad de ADN no genético entre ellos. Si representamos un cromosoma como una línea negra sólida (como es común en muchos libros de texto de genética), podemos "acercarnos" para ver las características de uno de sus muchos genes. En este caso, este es un gen que produce un producto proteico:

(Nota: el "punto" en la línea que representa el cromosoma es el centrómero, una secuencia de ADN a la que se adhieren los componentes celulares para arrastrar los cromosomas durante la división celular).

En primer lugar, podemos ver que las partes del gen que se utilizan para especificar la secuencia de aminoácidos de la proteína (los recuadros azules) son solo una parte del todo. Otras secuencias (como las representadas por las líneas celestes y los recuadros rojos) son secuencias que dirigen a ciertos tipos de células a producir esta proteína, y cuánto producir. Todas las secuencias representadas como recuadros se convierten en lo que se denomina "ARN mensajero" o "ARNm", una especie de versión monocatenaria del ADN, que es tan larga como la secuencia del gen y, a menudo, separa secuencias que se entrecruzan las secciones que codifican la estructura de la proteína (los llamados "intrones", que se pueden ver en la figura anterior). Esta “copia de trabajo” de ARNm del gen se usa luego para dirigir la síntesis de la proteína a través de un proceso llamado traducción.

Si todo esto parece un poco complejo, no se preocupe; para nuestros propósitos aquí, es suficiente reconocer que los genes son (a) una pequeña sección de una molécula de ADN mucho más larga (es decir, un cromosoma), (b) tienen algunas secuencias que determinan la secuencia de la proteína que codifican (es decir, el orden de sus aminoácidos), y (c) otras secuencias reguladoras que no son parte del código de la proteína en sí, pero que funcionan como señales para decirle a las células cuándo y dónde la proteína debe ser hecho o "expresado".

Ingrese variación

Con estos detalles en mente, ahora considere cómo la variación a nivel del ADN puede afectar la estructura cromosómica. Como vimos ayer, cuando se copian los cromosomas, pueden ocurrir errores de copia de ADN. No es sorprendente que muchos tipos de eventos de mutación también puedan afectar la función de los genes y, en última instancia, las características del organismo:

Mutaciones de un solo par de bases: el emparejamiento incorrecto de ácidos nucleicos puede dar lugar a copias de cromosomas que difieren del original en un par de bases (como vimos ayer). Estas denominadas “mutaciones puntuales” pueden ocurrir dentro de los genes (ya sea en el ADN regulador o en el ADN que codifica proteínas) o en las secuencias entre genes. Los cambios de un solo par de bases en el ADN que codifica la proteína pueden no tener ningún efecto sobre la proteína (ya que a menudo hay diferentes secuencias de ADN que producen la misma secuencia de aminoácidos, una característica conocida como "redundancia" del código genético). Otros cambios pueden alterar la secuencia de aminoácidos sustituyendo un aminoácido por otro, pero aún no tienen ningún efecto sobre la función de la proteína (ya que muchas funciones de la proteína pueden lograrse mediante secuencias de proteínas ligeramente diferentes). Otros cambios pueden reducir o incluso eliminar la función de las proteínas. Otros cambios podrían mejorar la función de las proteínas, por ejemplo, darle una mejor actividad enzimática.

También son posibles cambios en el ADN regulador, y los efectos de estos cambios pueden ser igualmente neutrales, dañinos o beneficiosos. Lo interesante del ADN regulador es que los pequeños cambios pueden tener efectos bastante importantes sobre dónde y cuándo se produce una proteína, y los cambios que alteran los genes clave que funcionan en las primeras etapas del desarrollo pueden tener efectos secundarios significativos en el organismo en su conjunto. Examinaremos esto con cierto detalle en publicaciones futuras de esta serie.

Eventos de eliminación: a veces, se pueden perder tramos de ADN durante la replicación cromosómica debido a eventos de rotura y reincorporación. A veces, las eliminaciones afectan solo a unos pocos pares de bases, pero en algunos casos pueden abarcar miles de pares de bases. Se pueden perder partes de genes, o incluso genes completos, y los genes que flanquean la deleción se acercan. Como hemos visto para las mutaciones puntuales, las deleciones pueden no tener ningún efecto, un efecto perjudicial o incluso un efecto beneficioso dependiendo del evento específico. Por ejemplo, a veces las deleciones eliminan las secuencias reguladoras que bloquean la expresión génica en ciertas células. La eliminación de esta secuencia permite que el gen se exprese donde no se expresó antes, lo que nuevamente podría ser neutral, dañino o beneficioso, según las circunstancias.

Eventos de duplicación: esto es lo opuesto a una deleción, donde una porción de la secuencia de un cromosoma se duplica y termina una al lado de la otra. En cuanto a las deleciones, las duplicaciones pueden ser pequeñas, o tener una longitud de miles de pares de bases, abarcando numerosos genes, y ser igualmente neutrales, dañinas o beneficiosas.

Un mecanismo común que produce duplicaciones y deleciones simultáneamente ocurre durante la recombinación en las células que dan lugar a óvulos o espermatozoides. Tal vez recuerde que "cruzamiento" es el término utilizado para describir la rotura física y la unión de los cromosomas para "mezclar y combinar" secuencias entre pares de cromosomas durante las divisiones celulares que conducen a los gametos (es decir, meiosis). Normalmente, los cromosomas se emparejan para este intercambio alineando sus secuencias (casi idénticas), seguidas de una ruptura precisa y una reincorporación:

Lo que puede suceder, a baja frecuencia, es que los pares de cromosomas no alineen sus secuencias correctamente. La alineación se basa en las mismas secuencias en cada cromosoma que se encuentran y se unen entre sí. Pueden ocurrir errores debido a secuencias repetitivas entre genes, secuencias que "engañan" a los cromosomas haciéndoles creer que han encontrado su alineación de secuencia correcta, cuando en realidad hay dos bucles de secuencia no aparejada, uno en cada cromosoma. Si se produce un cruce entre estos bucles, el resultado es un cromosoma con una duplicación y el otro con una deleción:

Por supuesto, esta lista de tipos de mutación no es exhaustiva (por ejemplo, hemos visto cómo los elementos de ADN parasitarios autónomos llamados transposones pueden insertarse en los cromosomas, alterando funciones o contribuyendo a otras nuevas).

Resumiendo: constancia y cambio

Tomados en conjunto, estos mecanismos introducen variación en las poblaciones y, dado que esa variación está en el ADN, la variación es hereditaria. La variación a nivel cromosómico puede influir en la función de los genes y, en última instancia, en los rasgos a nivel del organismo. Los cambios a nivel del ADN que causan una variación significativa a nivel del organismo están disponibles para que actúe la selección natural, y ya hemos visto ciertos ejemplos de mutaciones seleccionadas, como la duplicación de genes de amilasa en humanos y perros. Por supuesto, se seleccionan otras mutaciones y se pueden eliminar de las poblaciones con el tiempo. Las propiedades del ADN como agente de constancia y cambio hereditario significan que las poblaciones no son completamente estables genéticamente: pueden cambiar con el tiempo, aunque las características del ADN que lo convierten en un transmisor de información en gran medida preciso aseguran que esos cambios probablemente serán sutiles. unos a nivel del organismo.

Como veremos en la próxima publicación de esta serie, esta inestabilidad genética puede poner poblaciones separadas de la misma especie en trayectorias diferentes y permitir que se acumulen diferencias que, en última instancia, conduzcan a la formación de nuevas especies.


Belleza en la diversidad

Rick Guidotti construyó su carrera como fotógrafo de moda hasta que decidió que quería mostrar la belleza de una manera diferente. A través de su organización sin fines de lucro llamada Positive Exposure, comenzó a tomar hermosas fotografías de niños y adultos con afecciones genéticas que no siempre vemos en revistas o vallas publicitarias. El trabajo de Rick ha resaltado la belleza de la diversidad humana (en gran parte causada por la variación genómica). Puedes ver la verdadera alegría en su galería en línea, "Las nuevas caras de la genética y más allá". Rick ha seguido creando proyectos como FRAME (Rostros que redefinen el arte de la educación médica), que está diseñado para sustituir las imágenes de niños serios que se usan a menudo en la literatura médica y los libros de texto con fotografías alegres y cortometrajes divertidos. Como dice Rick, los estudiantes de medicina "van a ser mejores médicos, porque han visto a estos niños que no están en crisis. Han conocido a estos niños no en un entorno clínico, pero han visto a estos niños como personas".

El Proyecto Genoma Humano también ha llevado a un cambio en nuestra comprensión de los rasgos humanos y cómo los enseñamos; un ejemplo es el color de ojos. Durante muchos años, a los estudiantes se les enseñó que un gen dominante controlaba los ojos marrones o azules y que los padres de ojos azules no podían tener hijos de ojos marrones. Los científicos sabían que el rasgo de los ojos azules era en realidad más complicado a pesar de lo que se enseñaba en las escuelas, pero la tecnología desarrollada durante y después del Proyecto Genoma Humano ayudó a identificar la combinación real de variantes genómicas que determinan el color de los ojos. De hecho, al menos diez genes, cada uno de los cuales viene en varios "sabores", contribuyen al color de los ojos. Es la combinación de estas variantes genéticas en el genoma de una persona lo que produce la maravillosa gama de colores de ojos humanos. Otros rasgos son aún más complicados, por ejemplo, alrededor del 80 por ciento de la altura de una persona está controlada por más de 700 variantes genómicas, cada una de las cuales tiene una influencia muy pequeña.

Rick Guidotti construyó su carrera como fotógrafo de moda hasta que decidió que quería mostrar la belleza de una manera diferente. A través de su organización sin fines de lucro llamada Positive Exposure, comenzó a tomar hermosas fotografías de niños y adultos con afecciones genéticas que no siempre vemos en revistas o vallas publicitarias. El trabajo de Rick ha resaltado la belleza de la diversidad humana (en gran parte causada por la variación genómica). Puedes ver la verdadera alegría en su galería en línea, "Las nuevas caras de la genética y más allá". Rick ha seguido creando proyectos como FRAME (Rostros que redefinen el arte de la educación médica), que está diseñado para sustituir las imágenes de niños serios que se utilizan a menudo en la literatura médica y los libros de texto con fotografías alegres y cortometrajes divertidos. Como dice Rick, los estudiantes de medicina "van a ser mejores médicos, porque han visto a estos niños que no están en crisis. Han conocido a estos niños no en un entorno clínico, pero han visto a estos niños como personas".

El Proyecto Genoma Humano también ha llevado a un cambio en nuestra comprensión de los rasgos humanos y cómo los enseñamos; un ejemplo es el color de ojos. Durante muchos años, a los estudiantes se les enseñó que un gen dominante controlaba los ojos marrones o azules y que los padres de ojos azules no podían tener hijos de ojos marrones. Los científicos sabían que el rasgo de los ojos azules era en realidad más complicado a pesar de lo que se enseñaba en las escuelas, pero la tecnología desarrollada durante y después del Proyecto Genoma Humano ayudó a identificar la combinación real de variantes genómicas que determinan el color de los ojos. De hecho, al menos diez genes, cada uno de los cuales viene en varios "sabores", contribuyen al color de los ojos. Es la combinación de estas variantes genéticas en el genoma de una persona lo que produce la maravillosa gama de colores de ojos humanos. Otros rasgos son aún más complicados, por ejemplo, alrededor del 80 por ciento de la altura de una persona está controlada por más de 700 variantes genómicas, cada una de las cuales tiene una influencia muy pequeña.


Creación: hechos de la vida

El Dr. Parker, un destacado científico de la creación y ex orador de AiG, presenta los argumentos clásicos a favor de la evolución utilizados en las escuelas públicas, universidades y los medios de comunicación, y los refuta con un estilo entretenido y fácil de leer. ¡Imprescindible tanto para estudiantes como para profesores! Este es un gran libro para dárselo a un no cristiano como herramienta de testimonio.


El ADN no es el mismo en todas las células del cuerpo: se revelan las principales diferencias genéticas entre las células sanguíneas y de los tejidos

La investigación de un grupo de científicos de Montreal cuestiona una de las suposiciones más básicas de la genética humana: que cuando se trata de ADN, cada célula del cuerpo es esencialmente idéntica a todas las demás células. Sus resultados aparecen en la edición de julio de la revista. Mutación humana.

Este descubrimiento puede socavar la justificación detrás de numerosos estudios genéticos a gran escala realizados durante los últimos 15 años, estudios que se suponía que aislarían las causas de decenas de enfermedades humanas.

A excepción del cáncer, las muestras de tejido enfermo son difíciles o incluso imposibles de tomar de pacientes vivos. Por lo tanto, la gran mayoría de las muestras genéticas utilizadas en estudios a gran escala vienen en forma de sangre. Sin embargo, si resulta que las células sanguíneas y tisulares no coinciden genéticamente, estos ambiciosos y costosos estudios de asociación de todo el genoma pueden resultar esencialmente defectuosos desde el principio.

Este descubrimiento surgió de una investigación sobre las causas genéticas subyacentes de los aneurismas aórticos abdominales (AAA) dirigida por el Dr. Morris Schweitzer, el Dr. Bruce Gottlieb, la Dra. Lorraine Chalifour y sus colegas de la Universidad McGill y el Instituto Lady Davis de Investigación Médica afiliado en Montreal. Hospital General Judío. Los investigadores se centraron en BAK, un gen que controla la muerte celular.

Lo que encontraron los sorprendió.

El AAA es una de las enfermedades vasculares raras en las que se extraen muestras de tejido como parte de la terapia del paciente. Cuando los compararon, los investigadores descubrieron diferencias importantes entre los genes BAK en las células sanguíneas y las células de los tejidos procedentes de los mismos individuos, y el presunto "desencadenante" de la enfermedad residía únicamente en el tejido. Además, las mismas diferencias se hicieron evidentes posteriormente en muestras derivadas de individuos sanos.

"En enfermedades multifactoriales distintas del cáncer, por lo general solo podemos observar la sangre", explicó Gottlieb, genetista del Centro de Investigación Traslacional del Cáncer de McGill. "Tradicionalmente, cuando hemos buscado factores de riesgo genéticos para, digamos, enfermedades del corazón, hemos asumido que la sangre nos dirá lo que está sucediendo en el tejido. Ahora parece que este simplemente no es el caso".

"Desde una perspectiva genética, dejando de lado las implicaciones terapéuticas, la observación de que no todas las células son iguales es extremadamente importante. Esa es la conclusión", agregó. “Los estudios de asociación de todo el genoma se introdujeron con enorme entusiasmo hace varios años, y la gente esperaba grandes avances. Iban a extraer muestras de sangre de miles o cientos de miles de personas y encontrar los genes responsables de la enfermedad.

"Desafortunadamente, la realidad de estos estudios ha sido muy decepcionante y nuestro descubrimiento ciertamente podría explicar al menos una de las razones".

El AAA es un ensanchamiento y debilitamiento localizados de la aorta abdominal y afecta principalmente a hombres caucásicos de edad avanzada que fuman, tienen presión arterial alta y niveles altos de colesterol. A menudo no presenta síntomas, pero puede provocar rupturas aórticas que son fatales en el 90 por ciento de los casos.

Si las mutaciones descubiertas en las células de los tejidos realmente predisponen al AAA, presentan un objetivo ideal para nuevas terapias y pueden tener implicaciones terapéuticas aún más amplias.

"Esto probablemente tendrá repercusiones para la enfermedad vascular en general", dijo Schweitzer, del Departamento de Medicina de McGill. "Todavía no hemos analizado las arterias coronarias o cerebrales, pero sospecho que esta mutación puede estar presente en todos los ámbitos".

Schweitzer es optimista de que este descubrimiento puede conducir a nuevos tratamientos para la enfermedad vascular a corto o medio plazo.

"La línea de tiempo podría ser de cinco a diez años", dijo. "Primero tenemos que hacer experimentos de cultivo celular in vitro, probarlo en un modelo animal y luego desarrollar una molécula o proteína que afectará el producto del gen mutado. Este es el primer paso, pero es un paso importante".

Fuente de la historia:

Materiales proporcionados por Universidad McGill. Nota: El contenido puede editarse por estilo y longitud.


Cómo el modelo de programa informático explica la genética

Ahora que hemos definido brevemente el modelo de programa de computadora, veamos las estructuras y patrones en biología y veamos qué tan bien el modelo de programa de computadora puede explicar estas estructuras y patrones. Tenga en cuenta que el objetivo de este documento es solo introducir programas de computadora y el concepto de variables en la discusión del ADN. Debido a la naturaleza introductoria y al espacio limitado del artículo, los ejemplos se simplifican significativamente. El lector se beneficiará mejor si no infiere detalles no declarados, sino que recuerda que las máquinas usan programas de computadora con variables para realizar operaciones extremadamente complejas cada segundo de cada día. No utilizan secuencias u oraciones aleatorias. También puede ayudar a los lectores a reconocer que la informática tiene cursos completos dedicados a las estructuras de datos, por lo que el lector no debe asumir que el poder operativo de los programas de computadora se limita a las ilustraciones básicas de este artículo.

Tabla 1. Varias variantes de un cromosoma simplificado.

Secuencia 1TTGCACCTGCCTAACAACGAAGAAGACAA
Secuencia 2TTGCACCTGCCTAAAATCGAGGAAGACAA
Secuencia 3TTGCACCTGCCTAACAAACTAGATTTACT
Secuencia 4TTGCACCTGCCTAACAACGAAGAAGAACT
Secuencia 5TTGCACCTGCCTAAAATACTAGATTTCAA

Patrones matemáticos de herencia

Al discutir el trabajo de Gregor Mendel, Edward Willett describe las relaciones matemáticas encontradas en los ahora famosos experimentos con plantas de guisantes,

Cuando Mendel analizó sus datos, surgieron patrones. Cruzar plantas altas con bajas, por ejemplo, siempre produjo plantas altas. Sin embargo, si se permitiera que las plantas altas híbridas se autofecundaran, la siguiente generación tendría aproximadamente una planta baja de cada cuatro. En la siguiente generación, y en más generaciones después de esa, las plantas bajas siempre produjeron más plantas bajas, un tercio de las plantas altas produjeron solo plantas altas y los dos tercios restantes de las plantas produjeron plantas altas y bajas. , en la misma proporción de tres a uno. . . Mendel obtuvo esos resultados con cada uno de los siete rasgos que eligió estudiar (Willett 2005, p. 5).

Si bien el ejemplo descrito es solo uno de varios patrones matemáticos de herencia que se observan en la naturaleza, ilustra el punto de que la variación no es simplemente un continuo de modificaciones a una secuencia. En cambio, hay cuantos discretos que gobiernan la herencia. Esto sostiene firmemente que las variables que usamos para describir los rasgos hereditarios tienen un análogo del mundo real en el ADN, y que un modelo de información adecuado para el ADN debe contener variables. Debido a que el modelo del programa de computadora usa variables, es excelente para representar los patrones matemáticos de herencia.


¿Cuánta variación hay entre las moléculas de ADN de un mismo organismo? - Biología

Su navegador no admite marcos en línea o está configurado actualmente para no mostrar marcos en línea.

Históricamente, la química y la biología se desarrollaron como ciencias diferentes. Pero a medida que la biología y la genética se adentran cada vez más en el estudio de las moléculas, las líneas divisorias comienzan a difuminarse.

Hoy en día, es común escuchar un término como "biología molecular" o "genética molecular", pero esos términos hubieran sido incomprensibles para los científicos hace 50 años.

Según Erwin Chargaff, el `` padre '' de las reglas del emparejamiento de bases, el puente entre la biología y la química solo comenzó a entenderse en la década de 1940 con el descubrimiento de Osward T.Avery de que las unidades de la herencia, los genes, estaban compuestas de ADN (que por supuesto está compuesto por productos químicos: purinas y pirimidinas).

Las purinas son moléculas de doble anillo (bases), mientras que las pirimidinas son moléculas de un solo anillo (bases), y todo el ADN se compone de solo cuatro sustancias químicas:

  • (A) Adenine (purina)
  • (T) Thymine (pirimidina)
  • (C) Cytosina (pirimidina)
  • (GRAMO) GRAMOuanine (purina)

Aquí están las reglas de emparejamiento base de Chargaff:

A siempre se empareja con T

C siempre se empareja con GRAMO

Ya sabe que las purinas se unen con las pirimidinas, pero ¿por qué las purinas no pueden unirse con las purinas o las pirimidinas no pueden unirse con las pirimidinas?

Es porque no hay suficiente espacio para que dos purinas quepan dentro de la hélice y demasiado espacio para que dos pirimidinas se acerquen lo suficiente como para que se formen enlaces de hidrógeno entre ellas. (Como recordará, las moléculas del ADN se mantienen juntas mediante enlaces de hidrógeno).

Para comprender los enlaces químicos, debe recordar que los átomos tienen un núcleo de protones con carga positiva y neutrones con carga neutra. Electrones cargados negativamente dispuestos fuera del núcleo.

Es cómo se organizan estos electrones y cómo reaccionan con otros átomos lo que determina la naturaleza de los enlaces químicos que se forman entre ellos.

Hay tres tipos diferentes de enlaces químicos.

  1. Enlaces iónicos (también llamados enlaces electrovalentes) se forman entre átomos cuando uno o más electrones se transfieren completamente de un átomo a otro.
  2. Enlaces covalentes se forman entre átomos cuando dos átomos comparten uno o más pares de electrones.
  3. Enlaces de hidrógeno se forman entre el átomo de hidrógeno cargado positivamente en una molécula unida covalentemente y el área cargada negativamente de otra molécula unida covalentemente.

Como dijimos, las bases del ADN se mantienen unidas por enlaces de hidrógeno. Hay dos enlaces de hidrógeno entre A y T y tres enlaces de hidrógeno entre C y G.

Los enlaces entre el anticodón de una molécula de ARNt y el codón complementario de ARNm son catalizados por la aminoacil-ARNt sintetasa.

Las reglas del emparejamiento de bases nos dicen que si podemos "leer" la secuencia de nucleótidos en una hebra de ADN, podemos deducir inmediatamente la secuencia complementaria en la otra hebra.

Estas reglas también explican el fenómeno de que cualquiera que sea la cantidad de adenina (A) en el ADN de un organismo, la cantidad de timina (T) es la misma.

De manera similar, cualquiera que sea la cantidad de guanina (G) en el ADN de un organismo, la cantidad de citosina (C) es la misma.

Estas relaciones de pares de bases se denominan Reglas de Chargaff en honor al profesor de la Universidad de Columbia, cuyo equipo observó por primera vez las concentraciones iguales de A y T, y C y G, en la mayoría de las moléculas de ADN.

Aquí están las proporciones relativas de bases en el ADN de algunos organismos.

Proporciones relativas (%) de bases en el ADN
Organismo A T GRAMO C
Humano 30.9 29.4 19.9 19.8
Pollo 28.8 29.2 20.5 21.5
Saltamontes 29.3 29.3 20.5 20.7
Erizo de mar 32.8 32.1 17.7 17.3
Trigo 27.3 27.1 22.7 22.8
Levadura 31.3 32.9 18.7 17.1


Aquí hay algunas cosas más para recordar sobre el emparejamiento y la codificación básicos.

A base deletion early in the coding sequence of a gene may result in a nonsense mutation, a frameshift mutation, multiply missense mutations and a nonfuctional protein.

Base pair substitutions may have little effect on the resulting protein. That's because the redundancy of the code my result in a silent mutation, the missense mutation may not occur in a critical part of the protein, the new amino acid may have similar ties to the replaced amino acid and the wobble phenomenon would result in no change in translation.

Video Instruction
*Availability of You Tube video links may vary. eTAP has no control of these materials.


How much variation is there between DNA molecules from the same organism - Biology

School B iology Notes: The HUMAN GENOME - what is it? what is its importance?

Introduction to the GENOME of an organism & gene expression

The importance of knowing the human genome - the 'project'

Considering chromosomes, alleles, genotypes, phenotypes, variations

Notas de revisión de biología escolar de Doc Brown: biología GCSE, biología IGCSE, biología de nivel O,

Cursos de ciencias escolares de los grados 8, 9 y 10 de EE. UU. O equivalentes para

Estudiantes de biología de 14-16 años

Esta página le ayudará a responder preguntas como. ¿Qué es un gen? ¿Qué es un cromosoma? What is the human genome? What are alleles? What is the difference between genotype and phenotype? Give examples of medical applications of data from the human genome project. Why is genetic testing controversial?

(a) The connection between DNA, genes, alleles, chromosomes and the genome

los genoma is the whole of the genetic material of an organism - all of the DNA - coding and non-coding!

In animal and plant cells the genetic material (DNA) is contained in the cell nucleus and arranged in 'packages' called cromosomas.

Chromosomes often occur in pares p.ej. human cells have 23 pairs of chromosomes, 46 chromosomes in all.

Every chromosome is a very long strand of DNA that is coiled up to give it a characteristic shape.

Reminders: DNA is a very long natural polímero in which the monomer is a nucleótido that makes up the repeating unit in the molecular chain. The DNA molecule consists of two strands wound and bound together to form the double helix molecule.

For more on structure of DNA see DNA and Protein Synthesis gcse biology revision notes

A gene is a relatively short strand of DNA that forms a section of a chromosome that codes for a specific protein.

Each gene has the coded instructions to tell a cell to combine a particular sequence of amino acids to form a specific protein. In this case the monomer unit is an amino acid and the resulting polymer is called a protein.

Proteins control the development of an organism's characteristics and all its functions.

As if this wasn't complicated enough, there is an extra layer of complexity due to the existence of alleles!

Genes can exist in different versions called alelos - subtle differences in the genetic DNA code.

Each allele produces a different form of the same characteristic of an organism.

p.ej. brown or blue eyes is a good example.

Each chromosome in a pair carries the same genes, BUT, they may carry different alelos.

The diagram below sums up the relationship between all the terms described and explained above.

Nota: Genetic variants

Genetic variants (mutations) are caused by alterations in the common nucleotide sequences in the DNA of genes.

The term variant can be used to describe an alteration that may be benign (harmless), pathogenic (harmful), or of unknown significance.

The term variant is increasingly being used in place of the term mutation.

Variants are key to successful evolution because genotype changes (usually of the smaller type) can lead to changes in phenotype.

Humano variación genética es el genetic differences both within and among populations. There may be multiple variants of any given gene in the human population.

A mutation may defined as any change in a DNA compared to normal that results in a rare and abnormal variant .

For more on structure of DNA see DNA and Protein Synthesis gcse biology revision notes

For much more on mutations and variants see Genetic variation and mutations

(b) Genetic instructions and the characteristics of an organism

The combination of all alleles for each gene of an organism are called genotypes.

It is the genotypes of each organism that makes it único.

However, the characteristics shown by an organism are called their phenotypes.

The phenotype of an organism is primarily determined by the genotype, but the phenotype can be influenced by the environment the organism is interacting with.

p.ej. under what conditions does an organism grow and develop?

The diet of an animal can affect how well it grows and how healthy it is. A well nourished child grows strong and healthy. A malnourished child short of protein, vitamins etc. may have stunted growth, be too thin, physically weak and the immune system weakened so the individual is more susceptible to infectious diseases.

A flower exposed to lots of sunlight, rich soil and adequate water may grow a healthily rich green and have attractively coloured flowers. If a plant is deprived of enough sunlight, nutrients or water, it grows somewhat thinly and becomes limp, it tends to be yellowish rather than green and petal colours may fade.

In both of the above cases, the genotype determines the maximum healthy growth of organism, but this may be reduced by environmental factors.

Therefore the variation of the phenotype is determined by a combination of the genotype (genetic factors) and the conditions of growth and development (environmental factors).

(c) The importance of genome knowledge - the human genome project

The genome is the term that describes the total genetic material of an organism - all the DNA.

The human genome projects has mapped and identified all the genes found in human DNA.

Every organism has its own unique genome and scientists can now completely work it out - clever stuff!

Genome data is used to characterise species and help research plant and animal evolution patterns.

See note 3. below on the human genome.

los human genome has around 3 billion base pairs in the DNA sequences of the genes-chromosomes!

Apparently quite a lot of your DNA is 'basura', but don't worry, and we won't go into that, just study hard, play hard and enjoy life!

Thousands of scientists around the world have collaborated on the human genome project.

We now know the complete human genome and over 20,000 to 25,000 genes have been located on it, but although we know what many do (code for), there is much more to find out.

Around 1800 genes have been identified that relate to human diseases - and this data is the target of medical research to benefit medicine.

PLEASE NOTE that all humans share 99.9% of their genomes, which makes you think!

How is our understanding of the human genome helping science p.ej. evolution theory or medicine?

Any new drug must be targeted at some specific medical condition where there is a need.

The target might be blocking the action of an enzyme or a gene with a chemical agent (drug) you can interfere with the development of a disease e.g. the anti-cancer drugs used in chemotherapy treatments to reduce the growth of tumour cells or kill them.

Studies of the genomes and resulting proteins in both plants and animals are proving useful to identify 'targets'.

You then have to find a chemical that will have an effect on the target, fortunately there are databases of chemicals that have been previously screened for likely effectiveness.

The screening might not initially indicate the best molecule to 'hit the target' in a biochemical sense, but, it may provide a starter molecule - which you can then modify to make different derivative molecules, one of which might provide a more effective treatment.

p.ej. prediction and prevention of disease, testing for and treating inherited diseases, more effective medicines, BUT, there are ethical issues to deal with too.

1. It has been possible for genetic scientists to identify particular genes (genetic variants) in the genome that are linked to certain types of non-inherited diseases .

Hopefully it will lead to predicting predisposition to certain diseases, leading to early intervention with medical treatment and perhaps a preventing disease actually developing.

If you know what genes predispose people to certain diseases, medical advice can be more accurately given e.g. choice of diet and other lifestyle factors based on the results of genetic screening tests.

Many common diseases like cancer and heart conditions are caused by the interaction of different genes, as well as lifestyle factors.

Ver también I ntroduction to genetic variation - formation and consequence of mutations

and Stem cells and uses - leukaemia treatment

2. From the human genome project, by knowing the genes associated with an inherited disease ( genetic disorder ), we can understand it more clearly and then develop more effective treatments - which may involve genetic engineering itself.

We know inheriting certain genes greatly increase your risk of developing certain cancers, this can help with making lifestyle choices to minimise the risk of suffering from the disease - as with 1. above, its a sort of risk management situation.

In the UK newborn babies are routinely tested for particular genetic variants known to cause genetic disorders e.g. the double recessive allele that causes cystic fibrosis.

The results from genetic screening enables the medical treatment-management to begin promptly while the baby is still very young.

Children with leukaemia can have a genetic test to help decide which is the most effective treatment in terms of medication and its dose.

See further notes on genetic screening of an embryos or fetus (much more controversial)

y Introduction to the inheritance of characteristics and inherited disorders

It is hoped that all this new genetic science will lead to the development of better, and more personal, treatments for a wide range of medical conditions.

We are now developing drugs and other techniques that work at the molecular level in combating disease and tailored to suit the individual's body chemistry.

The variations in patients genetic variants (alleles) mean that one drug isn't necessarily as effective with all patients suffering from the same condition - so new drugs can be designed to suit these 'varying' patient situations.

3. We know certain alleles affect how our body responds to certain diseases and their treatment.

Scientists hope to use this knowledge to develop more effective drugs that can be specifically suited to patients with certain alleles in their genome.

Different drugs can be tested, and their effectiveness compared with the patient's alleles, and you can compare existing drugs with new ones.

It has been found that some breast cancer drugs are only effective in women if they have certain alleles in their genome.

4. To help in these medical quests, scientists are analysing the genomes of human pathogens to help us understand and control certain infectious diseases.

The complete genome of bacteria such as the deadly MRSA, which is resistant to antibiotics.

It is hoped that pathogen genome knowledge will allow swifter decisions as to the best treatment administered to patients i.e. determined by the genomics of the specific bacterial strain.

The science of human e volution and migration

The human genome project can be tackled by various genetic strategies.

(i) Analysis of data from people's Y chromosome inherited down the male line.

(ii) Analysing mitochondrial DNA inherited through mothers.

Our knowledge of the human genome is being used to trace the migration of certain populations across the continents of the world.

The latest research suggests that all modern humans have descended from a common ancestor who lived in Africa, and their descendents have spread over all over the Earth - moving by both land and sea.

This is known as the 'Out of Africa' theory and seems to have begun around 60 000 years ago.

Why did this happen?

Maybe change in climate, so seeking more food for hunter-gathering tribes?

It is known the climate in Africa at this time became much dryer - less rain, less plant life, less food for animals, less plants and animals for humans to eat.

All humans have a very similar genome .

In terms of ancestors - genetically, who you were and where you have been is 'hidden' in your genome! until, that is, modern DNA analysis reveals all .

However, as different populations of people migrated to different areas of the planet, small differences in DNA 'evolved' (incorporated) into their genome e.g. producing different skin or hair colour or facial features.

The genetic variation is as little as 0.001%, but even so, genetic scientists can work out when these new populations split off in a different 'genetic' and geographical direction.

People who are related will have an even more similar genome.

The human genome is being compared to some of closest relative in the world e.g. primates.

Ever since researchers sequenced the chimp genome in 2005, they have known that humans share about 99% of our DNA with chimpanzees, making them our closest living relatives - that should make you think!

(d) Genetic screening - using data from the human genome project - potential medical treatments - issues

Introducción

When you know that a particular allele causes an inherited genetic disorder you can take action e.g.

if an allele that causes an inherited disorder is identified, we could have regular medical checks for these specific diseases and get early diagnosis and subsequent treatment.

Genetic treatment might be able to cure the disease.

From the human genome project scientists can identify the genes and alleles that may be responsible for causing inherited disorders, and much faster prior to the mapping of the complete human genome.

Common diseases like cancer and heart conditions are caused by the interaction of our genes and our lifestyle factors.

If we know which genes predispose an individual to certain types of disease we could be given personal advice on diet and lifestyle (in general) to minimise the risk of suffering from particular diseases.

However, there are many issues to with genetic testing results e.g.

(i) From the point of view of potential parents, there maybe crucial choices regarding whether children may be born with a genetically inherited disorder - especially if both parents carried the same faulty allele.

(ii) Would las compañías de seguros be allowed to see your 'genetic profile', are they entitled to know it e.g. as regards health or life insurance?

More on these points below in section (d)

Examples of using genetic testing

Example 1. A couple wishing to start a family might wish to know whether there is a riesgo of the baby developing a genetic disorder. This another aspect of family planning at the discretion of parents.

This can involve genetic testing at various point e.g.

1. Prior to conception, parents can be tested to see if they are carriers of a defective gene known to cause a genetic disorder.

It may be known that one of the parents comes from a family line where a genetic disorder has occurred.

The parents may not suffer from the genetic disorder, but they may be a carrier of the defective gene.

The genetic tests would show if any parent was a carrier and the probability of the baby inheriting the disorder - the parents can then make an 'informed decision' as to whether to have a child.

ver Introduction to the inheritance of characteristics and inherited disorders

2. After conception or laboratory fertilisation, the embryo or feto (embryo >8 weeks old) can be tested - see section (ii) below on embryonic genetic testing.

A pregnant woman can be tested by extracting a sample of DNA from the amniotic fluid which surrounds the fetus in the womb - there is a very small risk of causing a miscarriage.

The tests will show whether the foetus's DNA is carrying any of the genetic variants linked with a disorder.

If a positive test for such a variant is found, the couple can then make an 'informed decision' as to whether to terminate or continue with the pregnancy - a very personal and agonising family planning decision.

3. The newborn baby can be genetically tested to show whether a genetic disorder has been inherited allowing early intervention of medical treatment and subsequent long-term management of the disorder.

Example 2. Using in vitro fertilisation (IVF) embryos are fertilised in a laboratory and then implanted into the mother's womb.

Prior to implantation it is possible to remove a cell from an embryo and analyse the DNA i.e, the genes and likely genotypes/phenotypes.

This allows the detection of genetic disorders e.g. cystic fibrosis (described above) which is caused by the presence of one or more faulty genes.

You can choose to allow a genetic disorder free embryo to fully develop into a baby in the mother's womb - this minimises the baby inheriting the genetic variants linked with the disorder.

However, this ability to analyse genes in this way leads to ethical, social and economic concerns and questions about embryonic testing i.e. embryo screening for abnormal-undesired genetic traits, on which crucial decisions can be made e.g. termination of pregnancy.

p.ej. after screening, embryos produced by IVF, containing abnormal alleles can be destroyed.

Example 3. Other points on genetic testing

Genome research data shows scientists the common genetic variations between people, most of which are benign and no danger to our health.

However, as I've already pointed out:

Some genetic variations are linked to our predisposition to certain disease - so this will help to design new drugs specifically tailored to suit people of a particular genetic trait.

In the UK newborn babies are routinely tested for particular genetic variants known to cause genetic disorders e.g. the double recessive allele that causes cystic fibrosis.

The results from genetic screening enables the medical treatment-management to begin promptly while the baby is still very young.

Arguments for embryonic/fetal screening and other genetic testing

(i) It stops newborn babies suffering as they grow up into adults.

(ii) Reducing the number of people suffering with a genetic disorder that is costly for healthcare systems to deal with.

(iii) Procedures like IVF, accompanied by genetic testing, are strictly regulated and parents are not allowed to choose desirable traits.

Parents are not allowed to choose the sex of their child, unless it is for good medical health reasons.

(iv) Other 'positive' points on genetic testing:

Early intervention for potentially serious diseases has already been mentioned.

Drugs for chemotherapy in cancer treatment are continually being developed and tested - you match a drugs performance against a person's specific genetic profile - this increases a 'working' database of treatment for future patients - another positive outcome from such treatment research is the minimising of side-effects which can quite drastic from ant-cancer drugs.

Arguments against embryonic/fetal screening and other genetic testing

Many objections centre around the ethical issues of IVF .

(i) IVF procedures often result in unused embryos being destroyed and some people consider this unethical - immoral, because you have destroyed a potential human life.

Even using embryos in research projects is considered to be unethical.

(ii) Terminations of IVF pregnancies on the grounds the baby may be born with a genetic disorder implies that the resulting children are undesirable and prejudice increased towards them.

Would potential parents feel under pressure NOT to have children with a potentially inherited genetic disorder.

(iii) The genetics and genetic testing of embryos before implantation in the mother's womb raises the ethical issue of preferential choice of characteristics of the baby p.ej. choice of gender, eye colour irrespective of whether you allow a child to be born with disabilities.

(iv) Genetic screening is costoso y el costs of gene technology treatments are high.

The cost increases, the more personal the treatment, because the more specialised the drugs must be.

Surely this risks unfair access to these expensive treatments?

In the UK NHS treatment is free - BUT, is it locally available? Can you jump the queue by using private medicine?

In other countries, or UK private medicine - what does your insurance premium cover?

(v) The accuracy of genetic testing

Unfortunately, due to the complexity of DNA structure, genetic testing is not 100% accurate.

A positive test for a faulty gene, that is incorrect, will causing stress to the couple, and possibly the wrong decision to terminate a pregnancy because of temor of the baby inheriting a genetic disorder when there is actually no need to be concerned.

A negative test for a faulty gene, that is incorrect, means the couple are completely unprepared for the birth of a child with a genetically inherited disorder, causing considerable stress in their lives when the baby is born.

(vi) Other 'negative' points on genetic testing:

Is the use of gene technology good in the long term, since we don't actually know what the effects will be on future generations?

What might you think if you know from an early age you are more susceptible (more predisposed) to a particular disease? Won't this lead to estrés thinking about it, especially if there isn't cure for it? Might you feel uneasy and worried if you 'parecer' to exhibit symptoms?

Would you be discriminated against by las compañías de seguros (e.g. insurance refusal or increased premiums) or employers (e.g. refused long-term job contract) if they knew you were likely to suffer from a genetically inherited disorder.

Society must decide on a code of conduct relating to potential discrimination AND privacy of your medical details.

Just imagine the problems caused if you genetic profile had to be submitted with a job application!

IGCSE revision notes genomes organism's characteristics genotype phenotype KS4 biology Science notes on genomes organism's characteristics genotype phenotype GCSE biology guide notes on genomes organism's characteristics genotype phenotype for schools colleges academies science course tutors images pictures diagrams for genomes organism's characteristics genotype phenotype science revision notes on genomes organism's characteristics genotype phenotype for revising biology modules biology topics notes to help on understanding of genomes organism's characteristics genotype phenotype university courses in biological science careers in science biology jobs in the pharmaceutical industry biological laboratory assistant apprenticeships technical internships in biology USA US grade 8 grade 9 grade10 AQA GCSE 9-1 biology science notes on genomes organism's characteristics genotype phenotype GCSE notes on genomes organism's characteristics genotype phenotype Edexcel GCSE 9-1 biology science notes on genomes organism's characteristics genotype phenotype for OCR GCSE 9-1 21st century biology science notes on genomes organism's characteristics genotype phenotype OCR GCSE 9-1 Gateway biology science notes on genomes organism's characteristics genotype phenotype WJEC gcse science CCEA/CEA gcse science


Virus de ADN frente a virus de ARN

¿Cuál es la diferencia entre los virus de ADN y los virus de ARN?

Los virus de ADN monocatenario son mucho menos comunes que los virus de ADN bicatenario. Con los virus de ARN, es lo contrario & # 8211 hay algunos ejemplos de virus de ARN de doble hebra, pero predominantemente son de hebra sencilla.

La estructura del virus del VIH (inmunodeficiencia humana)

La diferencia crucial entre los dos tipos de virus está en su capacidad para sintetizar proteínas. Mientras que los virus de ADN tienen que transcribir ADN en ARN para poder sintetizar proteínas, los virus de ARN pueden usar su propio ARN viral para hacerlo.


Replication - DNA Synthesis [back to top]

DNA is copied, or replicated, before every cell division, so that one identical copy can go to each daughter cell. The method of DNA replication is obvious from its structure: the double helix unzips and two new strands are built up by complementary base-pairing onto the two old strands.

DNA replication can take a few hours, and in fact this limits the speed of cell division. One reason bacteria can reproduce so fast is that they have a relatively small amount of DNA.

This replication mechanism is sometimes called semi-conservative replication, because each new DNA molecule contains one new strand and one old strand. This need not be the case, and alternative theories suggested that a "photocopy" of the original DNA could be made, leaving the original DNA conserved (conservative replication). The evidence for the semi-conservative method came from an elegant experiment performed in 1958 by Meselson and Stahl. They used the bacterium E. coli together with the technique of centrifugación en gradiente de densidad, which separates molecules on the basis of their density.

1. Grow bacteria on medium with normal 14 NH4

2. Grow bacteria for many generations on medium with 15 NH4