Información

¿Cómo se produce la polimerasa Taq?

¿Cómo se produce la polimerasa Taq?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

He visto Taq la polimerasa se comercializa como "nativa" o "recombinante". Entiendo que la versión recombinante se produce mediante modificaciones especiales Escherichia coli cepas que tienen el gen para la producción de polimerasa empalmado en ellas, pero me pregunto acerca de la variante "nativa". Me imagino que Thermus aquaticus es bastante difícil de cultivar en un medio; ¿Es por tanto cierto que los arqueos tienen que ser extraídos de los manantiales de donde vinieron para producir polimerasa "nativa"?


Para recombinante Taq polimerasa, la producción a escala industrial produce litros de enzima altamente concentrada en una sola corrida. Viene en cantidades tan pequeñas y diluidas cuando se vende que solo se necesitarían unas pocas preparaciones al año para satisfacer la demanda de los laboratorios de investigación.

No se el Thermus aquaticus protocolo, pero considerando los logros en rendimiento para E. coli, y la mínima diferencia de precio entre las dos enzimas, me imagino que los rendimientos son similares allí. Eso me diría que nadie cultiva aguas termales para T. aquaticus.


Un método simple y eficiente para la extracción de la ADN polimerasa Taq

ADN polimerasa termoestable (Taq Pol Ι) de Thermus aquaticus ha sido ampliamente utilizado en PCR, que generalmente se extraía con el método Pluthero & # x27s. El método utilizó sulfato de amonio para precipitar la enzima y ahorró esfuerzo y dinero, pero no tiempo. Además, encontramos que el 30-40% de actividad de Taq Pol I se perdió en el paso de precipitación con sulfato de amonio y el producto contenía una pequeña cantidad de ADN.

Resultados

Proporcionamos un método novedoso, simplificado y de bajo costo para purificar el Taq Pol Ι después de la sobreproducción de la enzima en Escherichia coli, que utilizó etanol en lugar de sulfato de amonio para precipitar la enzima. El precipitado se puede disolver directamente en el tampón de almacenamiento sin diálisis. Además, la contaminación de ADN y ARN se eliminó con DNasa I y RNasa A antes de la precipitación, y se optimizó el procedimiento de extracción. Nuestras mejoras aumentan la tasa de recuperación y la actividad específica de la enzima, y ​​ahorran mano de obra, tiempo y costos.

Conclusiones

Nuestro método utiliza etanol, DNasa I y RNasa A para purificar el Taq Pol Ι, simplifica la operación y aumenta la tasa de recuperación de la enzima y la calidad.


Taq ADN polimerasa (clonada)

Taq ADN polimerasa es una enzima de una sola subunidad purificada de la bacteria termófila Thermus aquaticus, la enzima nativa expresada en E. coli. Polimeriza el ADN de un cebador apareado a una plantilla de ADN en presencia de dNTP para PCR.

  • Enzima recombinante altamente purificada.
  • Excelente reproducibilidad de lote a lote.
  • Cada lote se prueba para que esté libre de contaminación por nucleasas.

La ADN polimerasa Taq (clonada) es la forma recombinante (segmentos de ADN de diferentes fuentes unidos) de la enzima nativa, expresada en E. coli. Esto sirve como fuente de energía para las reacciones celulares y participa en las vías de señalización.

Como la ADN polimerasa Taq (clonada) es una proteína recombinante excepcionalmente pura, proporciona una excelente reproducibilidad de lote a lote, a una temperatura óptima de 75 ° C, con la capacidad de sobrevivir a incubaciones repetidas a <95 ° C.

La ADN polimerasa Taq tiene licencia para su uso en PCR y se somete a pruebas exhaustivas para detectar actividades de nickasa contaminante, exonucleasa monocatenaria y bicatenaria y endonucleasa.


Taq PLUS ADN polimerasa (3 citas)

Taq Plus ADN polimerasa es una mezcla de Taq ADN polimerasa y Pfu, una ADN polimerasa de corrección de pruebas, que permite la amplificación de plantillas largas, hasta 20 kb, con alta fidelidad. Las dos enzimas actúan de forma sinérgica durante la PCR para generar productos de PCR más precisos y más largos con mayores rendimientos en comparación con la Taq ADN polimerasa sola. Los productos de PCR, amplificados hasta 20 kb de longitud con la ADN polimerasa Taq Plus, contienen una mezcla de extremos romos y una base única (A) 3 & rsquo que sobresale. La tasa de error de esta amplificación por PCR es de 7,5 x 10 -5 por nucleótido por ciclo.

ALMACENAMIENTO BUFFER

Tris.HCl 20 mM (pH 8.0), KCl 100 mM, MgCl 3 mM2, DTT 1 mM, Nonidet & reg P-40 al 0,1%, Tween & reg 20 al 0,1%, BSA 0,2 mg / ml, glicerol al 50% (v / v).

TAMPÓN DE PCR 10X

Tris-HCl 100 mM (pH 8,8), cloruro de potasio 500 mM, Triton al 1% y reg X-100, MgCl 16 mM2.

DEFINICIÓN DE UNIDAD

Una unidad (U) se define como la cantidad de enzima necesaria para catalizar la incorporación de 10 nanomoles de desoxirribonucleótidos en material insoluble en ácido en 30 minutos a 70 ° C utilizando ADN de esperma de arenque como sustrato.


Que es Taq Polimerasa

Taq La polimerasa es una ADN polimerasa termoestable disponible comercialmente que se utiliza en la PCR para sintetizar ADN. Se deriva de la eubacteria llamada Thermus aquaticus. El hábitat natural de la bacteria son las fuentes termales con temperaturas ambientales de 70-75 ° C. La estructura de Taq la polimerasa se muestra en Figura 1.

Figura 1: Taq polimerasa

Taq La polimerasa es una ADN polimerasa dependiente de ADN de 94 kD, que es homóloga a la ADN polimerasa 1 en E. coli. Por eso, Taq la polimerasa está compuesta por un sitio de adición de nucleótidos 3 & # 8242 -OH, el sitio de unión de dNTP / ADN y el sitio de exonucleasa 5 & # 8242 a 3 & # 8242. Sin embargo, carece del dominio de exonucleasa 3 & # 8242 a 5 & # 8242 para la corrección de pruebas de los nucleótidos entrantes.


Conclusiones

En resumen, una fusión NeqSSB-TaqS ADN polimerasa que consta de Taq Stoffel ADN polimerasa y la NeqProteína similar a SSB de Nanoarchaeum equitans exhibe una tasa de extensión mucho más alta, ofrece una mayor procesividad y tiene una mayor tolerancia a los inhibidores de la PCR en comparación con el Taq Stoffel ADN polimerasa. Por esta razón, en muchas aplicaciones de PCR, puede ser mejor utilizar un NeqSSB-TaqS ADN polimerasa en lugar de una Taq ADN polimerasa.


Enzima Taq

Una enzima taq es una enzima bacteriana que funciona en la fabricación de ácido desoxirribonucleico (ADN ). La capacidad de la enzima para funcionar a temperaturas más altas que otras bacterias que funcionan de manera similar. enzimas lo ha hecho valioso en el reacción en cadena de la polimerasa .

El apodo taq denota el origen de la enzima. La enzima es producida por una bacteria conocida como Thermus aquaticus. Esta bacteria fue descubierta por Thomas Brock a mediados de la década de 1970 en las aguas casi hirviendo de Mushroom pool, una fuente termal en el Parque Nacional de Yellowstone.

Taq es una ADN polimerasa. La enzima fabrica una hebra de ADN que es complementaria a una única hebra de ADN. Todos bacterias poseen ADN polimerasa. La razón por la que la polimerasa taq se ha vuelto tan importante para los procesos biotecnológicos es la resistencia de la enzima al calor. A Biología Molecular La técnica conocida como reacción en cadena de la polimerasa se basa en la exposición del ADN al calor para separar las dos hebras de la doble hélice. Luego, Taq puede usar ambas hebras simples como plantillas para la fabricación de dos nuevas hebras de ADN. Para realizar esta función, la polimerasa es capaz de reconocer el bloque de construcción particular, o nucleótido, en la hebra sencilla de ADN y luego colocar un nucleótido que sea el complemento complementario del objetivo particular. Se produce la unión de los dos nucleótidos. La polimerasa puede pasar al siguiente nucleótido y el proceso se repite. Cuando se deja enfriar la mezcla de ADN, las hebras coincidentes se unen formando dos hélices de ADN de doble hebra. Si este proceso se repite muchas veces, se puede fabricar una gran cantidad de copias de la región diana del ADN. La resistencia al calor de taq permite que la enzima funcione en las condiciones de temperatura que mantienen las cadenas de ADN separadas entre sí. La ADN polimerasa de otras bacterias, por ejemplo de la bacteria. Escherichia coli, no funcionan tan eficientemente en la reacción en cadena de la polimerasa como la polimerasa taq de Thermus aquaticus.

Desde el descubrimiento de la enzima taq y el desarrollo de la reacción en cadena de la polimerasa, la importancia de la enzima para la investigación de biología molecular y las aplicaciones comerciales de biotecnología se han disparado. La polimerasa Taq se usa ampliamente en el diagnóstico molecular de enfermedades y en medicina forense ("huellas dactilares de ADN"). Estas y otras aplicaciones de taq han generado una industria valorada en cientos de millones de dólares al año.

Ver también ADN (ácido desoxirribonucleico) Hibridación de ADN Extremófilos Biología molecular y genética molecular PCR


Comparación de la tasa de error durante la reacción en cadena de la polimerasa por la ADN polimerasa

A medida que los proyectos de clonación a gran escala se vuelven más frecuentes, existe una necesidad creciente de comparaciones entre las ADN polimerasas de alta fidelidad utilizadas para la amplificación por PCR. Todas las polimerasas comercializadas para aplicaciones de PCR son probadas por los proveedores para determinar las propiedades de fidelidad (es decir, la determinación de la tasa de error), y numerosos informes de la literatura han abordado la fidelidad de la enzima de PCR. No obstante, a menudo es difícil hacer comparaciones directas entre diferentes enzimas debido a las numerosas diferencias metodológicas y analíticas de un estudio a otro. Hemos medido las tasas de error para 6 ADN polimerasas que se usan comúnmente en aplicaciones de PCR, incluidas 3 polimerasas que se usan típicamente para aplicaciones de clonación que requieren alta fidelidad. Los valores de medición de la tasa de error informados aquí se obtuvieron mediante secuenciación directa de productos de PCR clonados. La estrategia empleada aquí permite interrogar la tasa de error en un espacio de secuencia de ADN muy grande, ya que se utilizaron 94 dianas de ADN únicas como plantillas para la clonación por PCR. Las seis enzimas incluidas en el estudio, Taq polimerasa, AccuPrime-Taq High Fidelity, KOD Hot Start, clonado Pfu polimerasa, Phusion Hot Start y Pwo polimerasa, encontramos las tasas de error más bajas con Pfu, Phusion y Pwo polimerasas. Las tasas de error son comparables para estas 3 enzimas y son & gt10 veces más bajas que la tasa de error observada con Taq polimerasa. Se informan los espectros de mutación, y las 3 enzimas de alta fidelidad muestran tipos de mutaciones muy similares. Para estas enzimas, predominan las mutaciones de transición, observándose poco sesgo para el tipo de transición.

1. Introducción

Con el rápido ritmo de desarrollo en la investigación basada en la biología de sistemas, por ejemplo, genómica, proteómica y metabolómica, los proyectos de descubrimiento biológico a gran escala se están volviendo más comunes. Dicho de otra manera, el alcance de muchos proyectos ha cambiado del estudio de uno o pocos objetivos al estudio de cientos, miles o más. Un ejemplo de investigación que ha sido transformada por los desarrollos en biología de sistemas es la clonación de marcos de lectura abiertos expresados ​​(ORF) a partir de sustratos de ADNc. El camino tradicional para la clonación de ORF generalmente ha comenzado con observaciones experimentales que impulsan la identificación de uno o varios genes de interés para una ruta en particular. La clonación de la (s) diana (s) normalmente dio como resultado un mayor refinamiento de los detalles de la ruta y, a menudo, la identificación de nuevas dianas de clonación. Con la creación y el continuo perfeccionamiento de las bases de datos de secuencias genómicas, la clonación ahora a menudo tiene lugar a una escala mucho mayor. Los avances en la tecnología de microarrays y la secuenciación de ADN han llevado a un gran aumento en el número de ORF presentes en las bases de datos biológicas. Además, las observaciones biológicas ya no preceden necesariamente a la identificación del objetivo, que ahora a menudo se basa en gran parte en predicciones y análisis basados ​​en bioinformática. Ejemplos de esfuerzos de clonación a gran escala incluyen proyectos de genómica estructural para determinar sistemáticamente las estructuras de proteínas [1], clonación de ORF de patógenos para comprender la enfermedad y los mecanismos terapéuticos [2], y la creación de todo el ORFeome humano que promoverá el desarrollo de las ciencias biomédicas básicas y aplicadas. [3].

Las ADN polimerasas utilizadas para amplificar dianas durante la clonación por PCR son enzimas de alta fidelidad con frecuencias de error típicamente en el rango de

mutaciones / pb amplificado [4]. Minimizar los errores generados por la PCR es especialmente importante para proyectos de clonación a gran escala porque, dado un conjunto suficientemente grande de secuencia de ADN diana, incluso las enzimas de alta fidelidad producirán clones con mutaciones. Existe una variedad de métodos para analizar la fidelidad de una ADN polimerasa. Sin embargo, las frecuencias de error para las enzimas de la PCR casi siempre se analizan utilizando una diana de ADN definida (o unas pocas) que muestrea una porción limitada del espacio de la secuencia de ADN. Los primeros estudios que utilizan la fidelidad relativamente baja Taq La ADN polimerasa se basó en la secuenciación de productos de PCR clonados (por ejemplo, [5, 6]). La secuenciación directa de clones era un enfoque práctico en ese momento debido a la baja fidelidad de la polimerasa, es decir, la mayoría de los clones que se secuenciaron contendrían al menos una mutación.

Con la introducción de polimerasas de mayor fidelidad, se desarrollaron nuevos métodos de detección para interrogar rápidamente a un gran número de productos de PCR en busca de mutaciones. Estos ensayos se basaron en un ensayo de fidelidad de mutación directa desarrollado por Kunkel y sus colegas, que utilizó una reacción de llenado de huecos con una ADN polimerasa en un lacZ secuencia de plantilla, seguida de ligadura y transformación en E. coli. Tramado colorimétrico basado en un funcional lacZ El gen permitió la identificación rápida de mutaciones, que posteriormente fueron secuenciadas para determinar la naturaleza de la alteración del ADN [7]. Se utilizó un enfoque similar para detectar mutaciones en los productos de PCR, clonando un lacZ fragmento amplificado por PCR en contraposición al simple llenado de huecos por ADN polimerasas. Este método, que a veces utiliza un gen indicador diferente, se ha utilizado para seleccionar una variedad de enzimas de PCR de alta fidelidad y optimizar las condiciones de reacción de PCR para minimizar las mutaciones [4, 8]. Finalmente, se han desarrollado métodos que se basan en el ensayo de mutaciones de PCR basadas en diferentes propiedades químicas (es decir, temperatura de fusión) de los productos de reacción con desajustes en relación con los dúplex perfectos y se han aplicado a una variedad de sistemas enzimáticos [9, 10]. Si bien los valores de fidelidad informados difieren entre los grupos de investigación y los métodos de ensayo, existe un consenso general de que una enzima de fidelidad relativamente baja como Taq tiene un valor de fidelidad en el

las enzimas de rango y de mayor fidelidad tienen valores que están en el rango (generalmente se informa como mutaciones por pb por duplicación de plantilla).

Una compensación involucrada en el uso de métodos de cribado como los descritos anteriormente es que generalmente solo se interroga una secuencia de ADN durante el ensayo. Además, las limitaciones incorporadas en los ensayos restringen aún más las posibles mutaciones que se pueden detectar. Por ejemplo, el ensayo basado en cribado lacZ Los productos de amplificación de genes utilizan un único objetivo de 1,9 kb, de los cuales sólo 349 bases producirán un cambio de color cuando se muten [11]. Asimismo, el ensayo de mutaciones basadas en perfiles de fusión dúplex diferencial está restringido a secuencias diana únicas que son lo suficientemente cortas, típicamente en el rango de 100 a 300 pb, y tienen perfiles de fusión térmica que permiten la resolución de desajustes únicos [9, 10].

Debido a que se sabe que los errores de la polimerasa dependen en gran medida del contexto de la secuencia de ADN (revisado en [12]), lo ideal sería utilizar un gran conjunto de secuencias de ADN al medir la fidelidad de la enzima. Esto se vuelve especialmente relevante en el contexto de proyectos de clonación a gran escala, que involucran cientos o miles de objetivos y, por lo tanto, contienen un espacio de secuencia de ADN casi infinito. Para ello, hemos diseñado y ejecutado un estudio que mide la fidelidad enzimática mediante la secuenciación directa de productos de PCR clonados. La caída de los costos de la secuenciación del ADN ha hecho que este método de determinación de la fidelidad sea práctico, incluso para las enzimas que cometen pocos errores. Nuestros objetivos son comparar los valores de fidelidad derivados de la secuenciación directa de clones con los derivados de métodos basados ​​en cribado, así como evaluar estos resultados en el contexto de la elección de una enzima para un proyecto de clonación de alto rendimiento.

2. Resultados y debate

Para determinar las tasas de error y observar los espectros mutacionales para una variedad de ADN polimerasas utilizadas en la clonación por PCR, secuenciamos directamente los clones producidos a partir de 94 moldes de plásmidos diferentes. Estos plásmidos, cada uno con una secuencia de ADN diana única, son un subconjunto de un grupo más grande de clones de glicosiltransferasa que hemos preparado a partir de Arabidopsis thaliana ADNc (manuscrito en preparación). Los 94 plásmidos tienen inserciones con un tamaño que varía de 360 ​​pb a 3,1 kb (mediana de 1,4 kb) y un contenido de GC que varía de 35% a 52% (mediana de 44%). En la Tabla 1 se presenta un resumen de las 6 ADN polimerasas utilizadas en este estudio. Taq polimerasa en nuestro estudio debido al extenso cuerpo de literatura que existe sobre las propiedades de fidelidad de esta enzima. Las otras enzimas incluidas se clasifican normalmente como "de alta fidelidad" y, por lo tanto, son candidatas potenciales para proyectos de clonación a gran escala. Y aunque la comparación de los valores de fidelidad es difícil debido a las diferencias en los métodos de ensayo y cuantificación entre los diferentes estudios, una clasificación general de las enzimas estudiadas aquí (de menor fidelidad a mayor) parece ser Taq & lt AccuPrime-Taq & lt KOD

Pfu Pwo & lt Phusion.

Nuestro proceso de clonación utiliza la inserción recombinacional de productos de PCR purificados en un vector plasmídico utilizando el sistema de clonación Gateway, un método ampliamente utilizado para estudios de clonación de alto rendimiento (revisado en [17]). Dado que nuestras plantillas de ADN de plásmido de entrada se prepararon utilizando el sistema Gateway, los genes diana de interés están todos flanqueados por att secuencias de recombinación. Esto permitió el uso de cebadores comunes para todas las reacciones de PCR, eliminando así la necesidad de optimizaciones específicas del objetivo. Se utilizó ADN plasmídico purificado como molde para la PCR y, en todos los casos, se utilizaron tampones recomendados por el proveedor. Usamos pequeñas cantidades de plantilla de plásmido (25 pg / rxn), con el fin de maximizar el número de duplicaciones en la reacción de PCR, y se tuvo en cuenta el tamaño del inserto en relación con el tamaño total del plásmido para determinar la cantidad de fragmento diana presente en la plantilla. El protocolo de PCR utilizó 30 ciclos de amplificación, con un tiempo de extensión de 2 minutos / ciclo para dianas ≤2 kb (82 de 94 dianas) y 4 minutos / ciclo para dianas & gt2 kb (12 de 94 dianas). La Figura 1 muestra imágenes de gel para un conjunto representativo de reacciones de PCR para cada enzima. En todos los casos, se observó una única banda de producto principal que migraba al tamaño esperado. La eficiencia de la amplificación se midió mediante la cuantificación del producto de la PCR utilizando un colorante específico de dsDNA y calculando el pliegue de amplificación basándose en una cantidad conocida de plantilla de ADN de entrada. La multiplicación de la amplificación se utiliza para determinar el número de duplicaciones de la plantilla que se produjeron durante la PCR. Como se informa en la Tabla 2, los valores de eficiencia de amplificación fueron bastante uniformes para todas las muestras dentro de una placa. Observamos eficiencias de amplificación similares entre diferentes enzimas, con la excepción de que habitualmente observamos menos duplicaciones de plantilla en reacciones con Pfu polimerasa. Hemos mantenido constantes los protocolos de termociclado para todas las enzimas, por lo que es posible que algunos parámetros no fueran óptimos para la amplificación por Pfu.

) es el promedio de los valores de duplicación para cada una de las 94 reacciones de PCR en una placa, donde las duplicaciones se calculan a partir de la fórmula

= (ng de ADN después de la entrada de PCR / ng de ADN). Tasa de error (F) se calcula como F =

es el número de mutaciones observadas para todos los clones que se secuenciaron y el (tamaño de la diana ×

para cada objetivo que se clonó.


Imágenes representativas de electroforesis en gel de agarosa de productos de amplificación por PCR de 24 dianas de ADN únicas, utilizando seis enzimas diferentes. Cada carril contiene 1/25 de toda la reacción de PCR. Los tamaños de producto esperados varían de 1,4 a 1,7 kb.

Después de la amplificación, los productos de la PCR se purificaron mediante precipitación con PEG / MgCl.2, que se sabe que fracciona selectivamente el ADN en función del tamaño [18], para eliminar los productos cortos & lt300 pb de tamaño. Este paso de precipitación se puede realizar en formato de placa de 96 pocillos, que es un requisito cuando el número de muestras aumenta. Hemos adoptado este protocolo para uso rutinario y hemos observado una mayor eficiencia para la inserción de ADN de tamaño correcto en el vector en comparación con la purificación mediante purificaciones de PCR basadas en kits, que normalmente tienen cortes de tamaño de

100 pb (datos no mostrados). En el caso de que estén presentes productos de PCR fuera del objetivo de & gt300 bp, se usa extracción en gel para aislar el producto deseado. Los productos de PCR purificados se incubaron con ADN de vector y BP Clonase II y se transformaron en células competentes. Se recogieron tres colonias por placa y se cultivaron en placas de 96 pocillos, y los cultivos se examinaron para determinar el tamaño correcto de inserto mediante PCR de colonias. Los valores de eficiencia de inserción para BP Clonase II, expresados ​​como el número promedio de clones que tienen un inserto en / cerca del tamaño esperado (de 3 colonias examinadas por transformación), fueron típicamente 80-90% (datos no mostrados). Para cada diana, se cultivaron uno o más clones para cada diana que contenían un inserto del tamaño correcto (si se obtuvo) y se usaron para la secuenciación del ADN.

Para fines de validación de métodos, utilizamos Taq ADN polimerasa, una ADN polimerasa de la familia A y la enzima utilizada en los primeros experimentos de PCR [6]. Como un caballo de batalla temprano en la tecnología de PCR, Taq La polimerasa se ha estudiado ampliamente con el propósito de determinar la fidelidad. Taq La ADN polimerasa carece de actividad exonucleasa 3 '→ 5' y, por lo tanto, no puede corregir los nucleótidos mal incorporados que se producen durante la síntesis de ADN. Se han utilizado varios ensayos para analizar Taq fidelidad y, dependiendo del método utilizado, valores de tasa de error (expresados ​​como mutaciones por par de bases por duplicación de plantilla) para Taq rango de polimerasa desde

(por ejemplo, [7, 20]). Además, el espectro mutacional de Taq La polimerasa se ha caracterizado, con las transiciones A • T → G • C predominando debido a la propensión de la enzima a incorporar incorrectamente la dCTP entrante con un nucleótido de timina molde [6, 9, 21].

Mediante secuenciación directa de clones de dos experimentos de PCR independientes con Taq polimerasa, observamos 99 mutaciones únicas de & gt100 kpb de la secuencia de ADN diana. El tipo y número de mutaciones individuales se enumeran en la Tabla 3. Dada la eficiencia de amplificación de cada reacción de PCR, la tasa de error (promedio de 2 experimentos) para Taq la polimerasa es

mutaciones / pb por duplicación de plantilla. Este valor está en excelente acuerdo con otros valores publicados para esta enzima, y ​​la varianza relativamente alta sugiere que los valores de error calculados que difieren hasta 2 veces probablemente no son significativos en relación con el ruido experimental. La mayoría de las mutaciones (67 de 99) son transiciones A • T → G • C, que podrían resultar de un emparejamiento incorrecto del dCTP entrante con la plantilla A o del emparejamiento incorrecto del dGTP entrante con la plantilla T. Transiciones del tipo G • C → A • T , como resultado del emparejamiento incorrecto de TTP entrante con la plantilla G o del emparejamiento incorrecto de dATP entrante con la plantilla C, son la segunda mutación más prevalente (28 de 99). Hubo 3 mutaciones de transversión, con 1 A • T → T • A y 2 A • T → C • G cambios. En general, el espectro de las mutaciones de sustitución de bases concuerda bien con las observaciones anteriores sobre Taq polimerasa reportada en la literatura [7]. Solo se observó una mutación de inserción o deleción (indel) en nuestro conjunto de datos, una sola deleción T en un

secuencia de plantilla. Taq Se ha informado que la polimerasa produce mutaciones indel con una frecuencia significativa, hasta aproximadamente el 25% de las mutaciones totales, y todas ocurren en series homopoliméricas [7]. Dado que nuestro grupo objetivo contiene 1481 instancias de ejecuciones de homopolímeros de al menos 4 pb, sospechamos que otras diferencias entre las condiciones de ensayo anteriores y las utilizadas aquí explican la discrepancia. Específicamente, los experimentos anteriores se realizaron con magnesio elevado (10 mM frente a 1,5 mM usado aquí) y niveles elevados de dNTP (1 mM frente a 0,2 mM usado aquí). Posteriormente, se demostró que tanto los niveles elevados de magnesio como de dNTP elevan las mutaciones de desplazamiento del marco de lectura (indel) preferentemente en relación con las mutaciones de sustitución de bases [21].

El método utilizado para generar la plantilla para la secuenciación del ADN requiere un control importante para estos experimentos. Para proyectos de clonación a mayor escala, la secuenciación de ADN utilizando cultivo celular es ventajosa debido al ahorro de tiempo y recursos en relación con la purificación del ADN plasmídico. Sin embargo, la secuenciación mediante cultivo celular requiere una PCR u otro paso de amplificación, y este paso podría, en principio, ser una fuente de "mutación adicional". Para abordar esto directamente, secuenciamos el ADN miniprep preparado a partir de un subconjunto de clones producidos con Taq polimerasa. También se observó cada una de las catorce mutaciones detectadas en el subconjunto usando cultivo celular como fuente para la plantilla de secuenciación cuando se realizó la secuenciación a partir de la plantilla de ADN plasmídico (datos no mostrados). Concluimos que nuestro método tiene una tasa de falsos positivos de & lt7% (1/14) y es aceptable para analizar mutaciones inducidas por PCR. Además, en base a nuestros resultados con Taq polimerasa, llegamos a la conclusión de que nuestro método para la determinación de la fidelidad da resultados en excelente acuerdo con otros estudios y, por lo tanto, es una medida precisa de la precisión de la polimerasa.

Nuestros resultados indican que 3 de las enzimas incluidas en el estudio, Pfu polimerasa, Phusion Hot Start y Pwo polimerasa, tienen tasas de error que son significativamente más bajas que las demás. Esto es consistente con hallazgos previos que demuestran una amplificación por PCR de muy alta fidelidad para estas enzimas. Curiosamente, los valores de frecuencia de error para estas tres enzimas son extremadamente similares entre sí, aproximadamente 2-3 × mutaciones / pb / duplicación de plantilla. Las ligeras diferencias en el valor de la frecuencia de error probablemente no sean significativas, dado que el pequeño número de mutaciones es producido por estas polimerasas de alta fidelidad además de la variabilidad experimental discutida anteriormente para los resultados con Taq. Dados los costos de clonación y secuenciación y los presupuestos de investigación finitos, la detección de mutaciones mediante la secuenciación del ADN de los clones genera un conjunto de datos relativamente pequeño de mutaciones cuando la fidelidad de la enzima es alta. Esto es un inconveniente para nuestro ensayo y, a pesar del hecho de que los costos de secuenciación del ADN continúan bajando, el cribado de bacterias sigue siendo un método mucho más económico para interrogar a un gran número de clones. Para todos los clones mutantes producidos por Pfu, Phusion Hot Start y Pwo polimerasas, las muestras se volvieron a secuenciar para descartar el procesamiento de muestras o la secuenciación del ADN como fuente de error. En todos los casos, la mutación original estaba presente, lo que confirma que la reacción de PCR es la fuente más probable de la mutación. Desde el punto de vista del uso en un proyecto de clonación a gran escala, cualquiera de estas enzimas sería aceptable, a juzgar por el criterio de minimizar la tasa de error. Por supuesto, se deben considerar otros factores, como la eficiencia de amplificación, los espectros de mutación, el rendimiento con plantillas de alto contenido de GC y el costo, por nombrar algunos. En cuanto a los espectros de mutación, las 3 polimerasas de alta fidelidad produjeron todas predominantemente (& gt75%) mutaciones de transición, sin sesgo de molde significativo. Con la enzima Phusion, observamos un 15% (2/13) de mutaciones indel, que son problemáticas para las aplicaciones de clonación en las que se debe mantener el marco de lectura de la traducción. Ambas mutaciones indel ocurrieron en regiones repetidas, siendo una una inserción A en una

secuencia de plantilla y la otra es una deleción (TCT) dentro de una

secuencia de plantilla. Este resultado fue inesperado a la luz de la alta procesividad de la polimerasa Phusion en relación con otras enzimas de PCR de uso común (sitio web del proveedor). Debido a que múltiples estudios han encontrado que el aumento de la procesividad de la polimerasa reduce la frecuencia de mutaciones de deslizamiento que resultan en mutaciones indel [22, 23], esperábamos que Phusion produjera la menor cantidad de errores de esta clase. Sin embargo, debe tenerse en cuenta que esta conclusión se basa en un tamaño de muestra pequeño y se debe analizar un mayor número de mutaciones para su confirmación.

Fue interesante para nosotros que ninguna de las enzimas probadas aquí tuviera una tasa de error por debajo de

2 ×. Otros estudios en la literatura han reportado frecuencias de error por debajo de 10-6 para enzimas de PCR,

[10] para Pfu polimerasa ensayada por dúplex diferencial Tmetro medición y 4,2 × para Phusion, utilizando tampón de HF ensayado con un método llamado BEAMING [16]. Para el estudio de la fidelidad de Phusion, la PCR utilizó un tampón diferente al empleado aquí, que según el proveedor da como resultado una tasa de error 2-3 veces menor. Además, ese estudio utiliza el método BEAMING, un protocolo de citometría de flujo extremadamente sensible que analiza una gran cantidad de perlas que contienen productos de PCR para detectar la presencia de variaciones de nucleótidos. Sin embargo, en ese estudio solo se examinó una mutación específica, una mutación G • C → A • T en una sola posición. Por tanto, aunque el ensayo es extremadamente sensible para la detección de mutaciones definidas, los resultados obtenidos con el método BEAMING para la frecuencia de mutación en una sola posición pueden no reflejar necesariamente las propiedades de fidelidad de una enzima para espacios de secuencia mucho más grandes. Para el estudio sobre Pfu tasa de error, existen varias diferencias metodológicas fundamentales: en el estudio anterior, la PCR se realizó en condiciones "casi anaeróbicas" con tiempos de ciclo significativamente más cortos, el tamaño del objetivo se limitó a 93 pb y la detección de mutaciones se basó en un método fisicoquímico: separación y aislamiento de productos de PCR que contienen desajustes por electroforesis capilar [10]. Y aunque este método se ha utilizado con éxito en la detección de mutaciones raras en muestras de ADN mitocondrial de tejidos normales y cancerosos [24], el requisito de que una mutación dé como resultado una molécula con un perfil de fusión alterado puede sesgar el número de mutaciones que pueden ser detectado. Una gran discrepancia entre nuestros resultados y los de este informe anterior sobre Pfu La fidelidad, que puede estar relacionada con las diferentes metodologías de detección de mutaciones, se puede ver en los resultados de los espectros de mutación en la Tabla 3. Observamos

90% (8 de 9) mutaciones de transición, con un ligero sesgo para las alteraciones G • C → A • T. Por el contrario, el estudio que utilizó electroforesis capilar para la detección resultó en mutaciones de transversión predominantemente (3/5), con una sola transición A • T → G • C y una sola mutación por deleción de 1 pb. Las mutaciones de transversión requieren que la polimerasa sintetice un desajuste de purina • purina o pirimidina • pirimidina, los cuales están significativamente desfavorecidos en relación con los diferentes desajustes de purina • pirimidina en las polimerasas de la familia B, que incluyen Pfu polimerasa [25, 26]. Debido a que los tipos de mutaciones que observamos son consistentes con los espectros mutacionales previamente informados para otras polimerasas de la Familia B, creemos que nuestro método ha detectado errores de polimerasa sin sesgos.

Las otras dos enzimas incluidas en nuestro estudio, la polimerasa KOD y AccuPrime-Taq Alta Fidelidad, tienen valores de fidelidad intermedios entre Taq polimerasa y las enzimas de mayor fidelidad. La tasa de error observada para la polimerasa KOD fue solo

4 veces más bajo que el de Taq polimerasa y

2,5 veces más alto que para Pfu polimerasa. El informe inicial sobre la fidelidad de la polimerasa KOD, una polimerasa tipo Pola de la familia B de Thermococcus kodakaraensis KOD1, informó una tasa de error muy ligeramente inferior a Pfu polimerasa y

4 veces más bajo que para Taq polimerasa [13]. Ese estudio usó un ensayo de mutación directa (no PCR), expresó fidelidad simplemente como la proporción de colonias blancas a azul sin tener en cuenta la eficiencia de amplificación de PCR, y usó condiciones experimentales (concentración de Mg 2+) que difieren significativamente de las condiciones típicas de PCR. Un estudio posterior que midió la fidelidad en condiciones de PCR, utilizando un gen informador diferente pero aún una proporción simple de colonias mutantes con respecto a las de tipo salvaje, informó tasas de error

50 veces más bajo que aquellos con Taq y marginalmente más bajos que los de Pfu polimerasa [14]. En ninguno de esos estudios hubo un informe de los cambios moleculares que condujeron a colonias mutantes. La gran diferencia entre estos dos resultados, que son del mismo grupo de investigación, sirve para resaltar las dificultades para realizar comparaciones entre estudios donde existen diferencias metodológicas significativas. In the present study, we find that the mutation spectrum for KOD polymerase is similar to the other B-family polymerases (Pfu, Pwo, and Phusion) assayed here. As shown in Table 3, transitions predominate (14 of 16 mutations), with a slight bias (64%) for A•T → G•C mutations.

For the PCR performed with AccuPrime-Taq High Fidelity system, we observed a 3-fold improvement in fidelity relative to Taq polymerase. According to the vendor, AccuPrime-Taq High Fidelity is an enzyme blend that contains Taq polymerase, a processivity-enhancing protein, and a higher fidelity proofreading polymerase from Pyrococcus especies GB-D. The lower error rate seen with AccuPrime-Taq most likely arises from the GB-D polymerase editing mistakes introduced by Taq polymerase as opposed to enhanced processivity since increased processivity has been shown to have no significant effect on base substitution errors [22, 27]. The mutation spectrum of the blend is almost identical to that seen with Taq polymerase alone, with transitions predominant and a significant bias for A•T → G•C changes (71% for AccuPrime-Taq versus 73% for Taq). However, it should be noted that a study on the mutation spectra of GB-D DNA polymerase (commercially available as Deep Vent) found A•T → G•C transitions to be the predominant mutation [28]. Detailed analysis on the contribution of each enzyme to the overall mutation spectrum is also precluded by the proprietary enzyme formulation used by the vendor.

In summary, we have used direct DNA sequencing of cloned PCR products to assay polymerase fidelity and evaluate other aspects of enzyme suitability for large-scale cloning projects. Based on minimizing PCR errors, Pfu polymerase, Pwo polymerase, and Phusion all produce acceptably low levels of mutations. Phusion was observed to produce more indel mutations than Pfu o Pwo polymerases, although the total number of mutations was limited. This type of mutation is particularly problematic for ORF cloning projects and should be taken into account in the process of enzyme selection. Aside from fidelity considerations, amplification efficiency values were significantly higher for Phusion and Pwo en comparación con Pfu, although further optimization of the PCR reaction for Pfu would likely improve efficiency values. Likewise, for cloning projects where targets are either very long or very highly GC-rich fidelity may be of lesser importance relative to the ability to amplify “difficult” target DNA. And finally, since the application space for PCR technology is huge, with cloning representing only a small fraction, enzymes other than those studied here need to be compared and evaluated based on project-specific needs and challenges.

3. Materiales y métodos

3.1. PCR Reactions

All enzymes and reaction buffers were from commercial sources: Fermentas (Taq polymerase), Invitrogen/Life Technologies (AccuPrime-Taq), EMD Chemicals/Novagen (KOD Hot Start), Agilent (cloned Pfu polymerase), Finnzymes (Phusion Hot Start), and Roche (Pwo polymerase). PCR reactions were carried out in a final volume of 50 μL using buffer conditions and enzyme amounts recommended by the vendor. For reactions with Phusion, the GC buffer was used. In all cases, reactions included 0.2 mM each dNTP (Fermentas) and 0.2 mM each primer (IDT) with the sequences (5′ to 3′) GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACC for the forward primer and GGGGACCACTTTGTACAAGAAAGCTGGGTC for the reverse primer. Template for PCR reactions was miniprep plasmid DNA, with each plasmid template containing a unique target sequence of known sequence and size, ranging from 0.3 to 3 kb. The target insert was cloned in between the att sites of a pDONR vector, allowing the use of a common primer set for all plasmids. Each PCR reaction contained 0.025 ng plasmid DNA, quantitated using the PicoGreen DNA quantitation reagent (Invitrogen/Life Technologies), and thus the amount of input target (I) was calculated as

ng (size of target ÷ (size of target + size of plasmid)). The thermocycling protocol for all reactions with target length ≤2 kb was 5 minutes, 95°C, then 30 cycles of 15 seconds, 95°C → 30 seconds, 55°C → 2 minutes, 72°C, and finally 7 minutes at 72°C. For the targets >2 kb in size, the 2-minute extension step was extended to 4 minutes. For analysis of PCR products by gel, 2 μL of each PCR reaction was run on a 2% agarose eGel (Invitrogen/Life Technologies) run according to vendor recommendations.

3.2. Quantitation of PCR Reactions

Efficiency of PCR amplification was determined by measuring the amount of product using a modified PicoGreen dsDNA quantitation assay. This method was facilitated by optimizing the PCR reaction to produce a single product band (Figure 1). Using a Biomek FX-P (Beckman) automated liquid handing system, 5 μL of each PCR reaction was diluted 50-fold in TE buffer (pH 8) into a new 96-well plate. From this plate, 5 μL from each well was mixed with 195 μL of PicoGreen solution, a 500-fold dilution of dye in TE (pH 8). Fluorescence measurements were taken with a Paradigm (Beckman) plate reader. Background fluorescence was determined from a PCR reaction that contained no template DNA. Following background subtraction, DNA concentration was determined by comparing fluorescence readings to those obtained with a standard curve using DNA of known concentration supplied with the dye. Extent of target amplification (mi) is calculated as mi = (ng DNA after PCR) ÷ (ng of target DNA input), and the number of template doublings during PCR (D) can be calculated as

3.3. Cloning of PCR Products

PCR reactions were purified in 96-well plate format by the addition of PEG 8000 and MgCl2 to final concentrations of 10% and 10 mM, respectively, directly to each well of the PCR plate using a multichannel pipettor. The plate was spun at 4000 rpm for 60 minutes at room temperature, and the supernatant was discarded. Pellets were washed two times with cold isopropanol, air-dried, and resuspended in 25 μL TE (pH 8). This protocol resulted in excellent yields (50–75%) of PCR products, with no products <300 bp, as judged by gel electrophoresis. Purified PCR products were cloned into a pDONR223 vector (a generous gift of Drs. Dominic Esposito and Jim Hartley, NCI, Frederick, MD) using BP Clonase II (Invitrogen/Life Technologies). Clonase reactions were assembled using a multichannel pipettor in 96-well PCR plates in a 5 μL volume and contained 75 ng pDONR223, 1 μL purified PCR product (typically 50–150 ng DNA), and 1 μL BP Clonase II. Sealed plates were incubated at least 16 hours at 25°C, and 1 μL of each reaction was immediately (no proteinase K treatment) used to transform either 25 μL or 50 μL of competent TOP10 cells (Invitrogen/Life Technologies). Following heat shock and recovery, following addition of 250 μL of SOC media, 100 μL of cells was plated on LB plates containing 50 mg/mL spectinomycin. Equivalent numbers of colonies were observed in transformations using 25 μL or 50 μL of frozen competent cells, and control BP reactions lacking BP Clonase II or PCR product resulted in no transformants.

3.4. Screening of Transformants

Three colonies from each transformation plate were picked and cultured in 96-well plates (Costar 3788) sealed with gas-permeable membrane, with each colony incubated in 150 mL of LB media with 50 mg/mL spectinomycin and 10% glycerol. After overnight incubation at 37°C (no shaking), 1 μL of each culture was used to screen by colony PCR for the presence of insert with expected size. Colony PCR reactions (25 mL) used the same primers used for cloning at a final concentration of 0.1 mM each, with 30 amplification cycles as described above, with GoTaq polymerase (Promega). Reactions were analyzed by agarose gel electrophoresis, and the presence of a band at or near the expected size was scored as a “hit.” The number of hits (0–3) for each target was determined, and an average number of hits per target for each plate were determined and used as a measure of Clonase reaction efficiency.

3.5. Clone Sequencing

In cases where Clonase efficiency values were >66%, average of at least 2 hits out of 3 colonies screened, the entire liquid culture plate was replicated with a 96-pin replicator onto an agar plate with the same dimensions as a 96-well plate. The plate was immediately submitted to an outside vendor (Quintarabio, Berkeley, CA), and after growth overnight sequencing was performed on amplified DNA from each clone. If Clonase efficiency values were <66% (Taq y Pfu polymerase reactions), a rearray step was added, using a Qpix2 colony picking robot (Genetix) to maximize the number of clones with correct-size insert on one plate. For comparing sequencing results using cells versus miniprep DNA, one plate of colonies picked from a Taq cloning reaction was replicated into a 96-well deep well plate with 800 mL media per well and grown overnight with shaking at 300 rpm. Cells were pelleted, and DNA was prepared using a Qiaprep 96 Turbo Miniprep Kit (Qiagen). Eluted DNA was submitted directly for sequencing.

Conflicto de intereses

Los autores declaran que no existe ningún conflicto de intereses con respecto a la publicación de este artículo.

Expresiones de gratitud

This work was part of the DOE Joint BioEnergy Institute (http://www.jbei.org) supported by the U.S. Department of Energy, Office of Science, Office of Biological and Environmental Research, through Contract DE-AC02-05CH11231 between Lawrence Berkeley National Laboratory and the U.S. Department of Energy. The authors would like to thank Drs. Dominic Esposito and Jim Hartley (NCI, Frederick, MD) for the gift of pDONR223 DNA, Huu M. Tran (JBEI/Sandia National Laboratories) for assistance with the laboratory automation, Drs. Richard Shan and Sue Zhao (Quintara Biosciences, Berkeley, CA) for DNA sequencing and analysis, and Dr. Nathan J. Hillson for critical reading of the paper.

Referencias

  1. B. G. Fox, C. Goulding, M. G. Malkowski, L. Stewart, and A. Deacon, “Structural genomics: from genes to structures with valuable materials and many questions in between,” Métodos de la naturaleza, vol. 5, no. 2, pp. 129–132, 2008. View at: Publisher Site | Google Académico
  2. A. Rolfs, W. R. Montor, S. Y. Sang et al., “Production and sequence validation of a complete full length ORF collection for the pathogenic bacterium Vibrio cholerae,” Actas de la Academia Nacional de Ciencias de los Estados Unidos de América, vol. 105, no. 11, pp. 4364–4369, 2008. View at: Publisher Site | Google Académico
  3. G. Temple, P. Lamesch, S. Milstein et al., “From genome to proteome: developing expression clone resources for the human genome,” Human Molecular Genetics, vol. 15, no. 1, pp. R31–R43, 2006. View at: Publisher Site | Google Académico
  4. J. Cline, J. C. Braman, and H. H. Hogrefe, “PCR fidelity of Pfu DNA polymerase and other thermostable DNA polymerases,” Investigación de ácidos nucleicos, vol. 24, no. 18, pp. 3546–3551, 1996. View at: Publisher Site | Google Académico
  5. A. M. Dunning, P. Talmud, and S. E. Humphries, “Errors in the polymerase chain reaction,” Investigación de ácidos nucleicos, vol. 16, no. 21, p. 10393, 1988. View at: Publisher Site | Google Académico
  6. R. K. Saiki, D. H. Gelfand, S. Stoffel et al., “Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase,” Ciencias, vol. 239, no. 4839, pp. 487–491, 1988. View at: Publisher Site | Google Académico
  7. K. R. Tindall and T. A. Kunkel, “Fidelity of DNA synthesis by the Thermus aquaticus DNA polymerase,” Bioquímica, vol. 27, no. 16, pp. 6008–6013, 1988. View at: Publisher Site | Google Académico
  8. J. M. Flaman, T. Frebourg, V. Moreau et al., “A rapid PCR fidelity assay,” Investigación de ácidos nucleicos, vol. 22, no. 15, pp. 3259–3260, 1994. View at: Publisher Site | Google Académico
  9. P. Keohavong and W. G. Thilly, “Fidelity of DNA polymerases in DNA amplification,” Actas de la Academia Nacional de Ciencias de los Estados Unidos de América, vol. 86, no. 23, pp. 9253–9257, 1989. View at: Publisher Site | Google Académico
  10. P. André, A. Kim, K. Khrapko, and W. G. Thilly, “Fidelity and mutational spectrum of Pfu DNA polymerase on a human mitochondrial DNA sequence,” Investigación del genoma, vol. 7, no. 8, pp. 843–852, 1997. View at: Google Scholar
  11. G. S. Provost, P. L. Kretz, R. T. Hamner et al., “Transgenic systems for in vivo mutations analysis,” Mutation Research-Fundamental and Molecular Mechanisms of Mutagenesis, vol. 288, no. 1, pp. 133–149, 1993. View at: Publisher Site | Google Académico
  12. T. A. Kunkel and K. Bebenek, “DNA replication fidelity,” Annual Review of Biochemistry, vol. 69, pp. 497–529, 2000. View at: Publisher Site | Google Académico
  13. M. Takagi, M. Nishioka, H. Kakihara et al., “Characterization of DNA polymerase from Pyrococcus sp. strain KOD1 and its application to PCR,” Microbiología aplicada y ambiental, vol. 63, no. 11, pp. 4504–4510, 1997. View at: Google Scholar
  14. M. Kitabayashi, Y. Nishiya, M. Esaka, M. Itakura, and T. Imanaka, “Gene cloning and polymerase chain reaction with proliferating cell nuclear antigen from Thermococcus kodakaraensis KOD1,” Bioscience, Biotechnology and Biochemistry, vol. 66, no. 10, pp. 2194–2200, 2002. View at: Publisher Site | Google Académico
  15. K. S. Lundberg, D. D. Shoemaker, M. W. W. Adams, J. M. Short, J. A. Sorge, and E. J. Mathur, “High-fidelity amplification using a thermostable DNA polymerase isolated from Pyrococcus furiosus,” Gene, vol. 108, no. 1, pp. 1–6, 1991. View at: Publisher Site | Google Académico
  16. M. Li, F. Diehl, D. Dressman, B. Vogelstein, and K. W. Kinzler, “BEAMing up for detection and quantification of rare sequence variants,” Métodos de la naturaleza, vol. 3, no. 2, pp. 95–97, 2006. View at: Publisher Site | Google Académico
  17. G. Marsischky and J. LaBaer, “Many paths to many clones: a comparative look at high-throughput cloning methods,” Investigación del genoma, vol. 14, no. 10, pp. 2020–2028, 2004. View at: Publisher Site | Google Académico
  18. J. T. Lis, “Fractionation of DNA fragments by polyethylene glycol induced precipitation,” Methods in Enzymology, vol. 65, no. 1, pp. 347–353, 1980. View at: Publisher Site | Google Académico
  19. J. J. Choi, J. Song, H. N. Ki et al., “Unique substrate spectrum and PCR application of Nanoarchaeum equitans family B DNA polymerase,” Microbiología aplicada y ambiental, vol. 74, no. 21, pp. 6563–6569, 2008. View at: Publisher Site | Google Académico
  20. L. L. Ling, P. Keohavong, C. Dias, and W. G. Thilly, “Optimization of the polymerase chain reaction with regard to fidelity: modified T7, Taq, and vent DNA polymerases,” PCR Methods and Applications, vol. 1, no. 1, pp. 63–69, 1991. View at: Publisher Site | Google Académico
  21. K. A. Eckert and T. A. Kunkel, “High fidelity DNA synthesis by the Thermus aquaticus DNA polymerase,” Investigación de ácidos nucleicos, vol. 18, no. 13, pp. 3739–3744, 1990. View at: Publisher Site | Google Académico
  22. J. F. Davidson, R. Fox, D. D. Harris, S. Lyons-Abbott, and L. A. Loeb, “Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase,” Investigación de ácidos nucleicos, vol. 31, no. 16, pp. 4702–4709, 2003. View at: Publisher Site | Google Académico
  23. E. Viguera, D. Canceill, and S. D. Ehrlich, “Replication slippage involves DNA polymerase pausing and dissociation,” El diario EMBO, vol. 20, no. 10, pp. 2587–2595, 2001. View at: Publisher Site | Google Académico
  24. K. Khrapko, H. Coller, P. André et al., “Mutational spectrometry without phenotypic selection: human mitochondrial DNA,” Investigación de ácidos nucleicos, vol. 25, no. 4, pp. 685–693, 1997. View at: Publisher Site | Google Académico
  25. A. Niimi, S. Limsirichaikul, S. Yoshida et al., “Palm mutants in DNA polymerases α y η Alter DNA replication fidelity and translesion activity,” Biología molecular y celular, vol. 24, no. 7, pp. 2734–2746, 2004. View at: Publisher Site | Google Académico
  26. E. M. Kennedy, C. Hergott, S. Dewhurst, and B. Kim, “The mechanistic architecture of thermostable Pyrococcus furiosus family B DNA polymerase motif A and its interaction with the dNTP substrate,” Bioquímica, vol. 48, no. 47, pp. 11161–11168, 2009. View at: Publisher Site | Google Académico
  27. T. A. Kunkel, S. S. Patel, and K. A. Johnson, “Error-prone replication of repeated DNA sequences by T7 DNA polymerase in the absence of its processivity subunit,” Actas de la Academia Nacional de Ciencias de los Estados Unidos de América, vol. 91, no. 15, pp. 6830–6834, 1994. View at: Publisher Site | Google Académico
  28. H. Huang and P. Keohavong, “Fidelity and predominant mutations produced by deep vent wild-type and exonuclease-deficient DNA polymerases during in vitro DNA amplification,” DNA and Cell Biology, vol. 15, no. 7, pp. 589–594, 1996. View at: Publisher Site | Google Académico

Derechos de autor

Copyright © 2014 Peter McInerney et al. Este es un artículo de acceso abierto distribuido bajo la licencia de atribución de Creative Commons, que permite el uso, distribución y reproducción sin restricciones en cualquier medio, siempre que el trabajo original se cite correctamente.


How is Taq polymerase produced? - biología

Polimerasa taq is a thermostable DNA polimerasa named after the thermophilic bacterium Thermus aquaticus from which it was originally isolated by Thomas D. Brock in 1965 . It is often abbreviated to "Taq Pol", and is frequently used in polimerasa chain reaction (PCR).
Full article >>>

Que es Taq polimerasa? Taq polimerasa is a DNA polimerasa (enzyme) isolated from the heat-tolerant bacterium Thermus aquaticus
Full article >>>

Taq ADN Polymerase is the most common polimerasa used for PCR reactions. . Applications: Taq ADN Polymerase can be used in most applications including the .
Full article >>>

<em>Taq</em> DNA Polymerase is a thermostable DNA polimerasa that possesses a 5' . Cuando debe Taq ADN Polymerase be used in a primer extension reaction or for PCR? .
Full article >>>

<I>Taq</I> DNA Polymerase is a thermostable DNA polimerasa that possesses a 5' . Cuando debe Taq ADN Polymerase be used in a primer extension reaction or for PCR? .
Full article >>>

High quality,Recombinant Taq ADN Polymerase:EUR0.01/Unit!Order your free sample today!Bulk order,please contact us.Email:[email protected] .org.cn
Full article >>>

Fastest to activate chemically modified hot start Taq ADN polimerasa. . 5-6 - Taq ADN Polymerase (temperature-dependent inhibitor), Vendor B .
Full article >>>

Taq ADN Polymerase has no detectable 3'=>5' exonuclease (proofreading) activity . The error rate of Taq ADN Polymerase in PCR is 2.2x10-5 errors per nt per cycle, .
Full article >>>

Taq Polymerase. GENTAUR EUROPE +32 1658 9045 +32 1650 9045. BELGIUM. tel +32 2 732 5688 . Very robust Taq ADN Polymerase. 500u. BIO-21040. 93 Euro. BIOTAQ .
Full article >>>

Taq polimerasa summary with 3 pages of encyclopedia entries, essays, summaries, research information, and more. . Taq Polymerase : Forensic Science Terms. 35 .
Full article >>>

Taq polimerasa. Different concentrations of a Taq polimerasa were tested using primer mixture C . Five native Taq polymerases, from five different sources, .
Full article >>>

Detection of viral RNA by polimerasa chain reaction (PCR) requires the prior . of this phenomenon has revealed direct interference of RT with Taq polimerasa. .
Full article >>>

. a broad range of pcr reagents,including taq polimerasa, PCR master mix, dNTPs, High-Stability PCR . Our best-sell Taq ADN Polymerase offers your cost .
Full article >>>

JNetDirect Biosciences - Biotechnology software, equipment and supplies distributor. . Taq ADN Polymerase. TthPlus DNA Polymerase. Anti-Taq Monoclonal .
Full article >>>

Generally, standard Taq ADN Polymerase has difficulty amplifying targets >5 kb. . general guidelines for primers to be used with Takara's Ex TaqPolymerase? .
Full article >>>

Britannica online encyclopedia article on taq polimerasa (enzyme), . replenished after every cycle because it is not stable at the high temperatures needed for .
Full article >>>

Taq polimerasa. From Molecular Biology Wiki. Jump to:navigation, search. Taq polimerasa is a thermostable DNA polimerasa named after the thermophilic .
Full article >>>

PCR reagents from Bionexus include DNA amplification kits, DNA polymerases, and PCR Premixes to . Modified Taq polimerasa activates at high .
Full article >>>


Direcciones futuras

Many properties affect the efficacy and utility of a PCR polymerase. Polymerase active site architecture and proofreading activity affect the accuracy of the final product. Polymerase blends and fusion to a DNA binding protein confer superior PCR performance for amplicon length and, in the case of the chimera, reaction speed. Other important advances in PCR, such as hot-start polymerases to increase reaction specificity, multiplex PCR (Figure 5) and qPCR have also revolutionized the life sciences.

As demonstrated by engineered blends and chimeras, properties of the polymerase itself can be modulated to improve PCR performance. In the future, it is likely that polymerase properties will increasingly be tailored to specific PCR applications, and as such, this is an important area of research at NEB.

Figure 5: The Multiplex PCR 5X Master Mix includes Taq DNA Polymerase and buffer that has been optimized for amplification of multiple targets. Its performance is illustrated in a 15-plex reaction with various amounts of human genomic DNA as template (shown below gel).


Ver el vídeo: Taq DNA polymerase (Junio 2022).