Información

Ensamblaje Gibson: diseño de imprimación con regiones ricas en A y T

Ensamblaje Gibson: diseño de imprimación con regiones ricas en A y T



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Tengo una pregunta sobre el montaje de Gibson. Lo he hecho varias veces y siempre funcionó bien para nosotros, pero ahora quiero ensamblar un fragmento que tenga una secuencia como esta: 5'CTTTTTCTTCGTCGAAAAAGGCAATAAAAATTTTTATCACGTTTCTT3 '.

¿Crees que las repeticiones AA y TT causarán algún problema? Usualmente usamos 30 pb de homología en ambos lados de la secuencia. ¿Debería usar más en este caso? ¿Cuáles son sus experiencias con respecto a estas secuencias repetitivas de AT?

gracias, Martin Kavšček


Solución de problemas de su experimento de clonación de plásmidos

La clonación puede ser un proceso bastante arduo. Es posible que la PCR no produzca un producto, que la transformación no produzca células o que todas las colonias examinadas no contengan el plásmido correcto. ¡Hay muchas cosas que pueden salir mal! Con todos los pasos del proceso de clonación, también hay muchas formas de solucionar los problemas del experimento de clonación. Aquí hay algunos consejos que lo ayudarán con su proyecto de clonación y, con suerte, obtendrá su codiciado plásmido sin demoras sustanciales.


Opciones de acceso

Obtenga acceso completo a la revista durante 1 año

Todos los precios son precios NETOS.
El IVA se agregará más adelante en el proceso de pago.
El cálculo de impuestos se finalizará durante el pago.

Obtenga acceso a artículos por tiempo limitado o completo en ReadCube.

Todos los precios son precios NETOS.


Beneficios de la tecnología de clonación de ensamblajes GeneArt Gibson

Los kits de montaje EX de GeneArt Gibson son ideales para montar varios insertos.

Figura 1. Los kits de clonación GeneArt Gibson Assembly EX brindan opciones de alta eficiencia de transformación cuando se utilizan grandes cantidades de insertos. Ensamblaje de 6, 8 y 10 fragmentos de 0.5kb en pcDNA 3.4 transformados en Invitrogen TOP10 Competent Cells.

Los kits GeneArt Gibson Assembly HiFi ofrecen una forma muy rentable y eficiente de ensamblar cantidades más pequeñas de fragmentos. Para ensamblajes más grandes, están disponibles los kits y mezclas maestras GeneArt Gibson EX.

Figura 2. Los kits GeneArt Gibson Assembly HiFi brindan una alta eficiencia de clonación utilizando un solo inserto para múltiples diseños de inserto. Ensamblaje de 1, 2 y 4 - fragmentos de 1 kb en pCDNA 3.4 usando células competentes TOP10. Los kits GeneArt Gibson Assembly HiFi son el método más rentable y el método que ahorra tiempo para construir ensamblajes grandes, particularmente cuando se usan con Fragmentos de ADN GeneArt Strings o GeneArt Gene Synthesis 100% secuenciado.


La causa de sus problemas

Problema 1. Estabilidad: térmica y estructural

Las secuencias de ADN ricas en GC son más estables que las secuencias con bajo contenido de GC. Para la PCR, esto significa que cuanto mayor es el contenido de GC, mayor es el punto de fusión del ADN. Bajo presión, como cuando se exponen al calor, las secuencias ricas en GC pueden sufrir mucho más abuso que las secuencias GC bajas. Si bien aún no se ha investigado el posible papel de la meditación y el yoga en tener efectos calmantes sobre estas bases, permitiéndoles soportar más abusos y aun así mantenerse unidos, sí se ha investigado el impacto de su estructura. Las secuencias de ADN ricas en GC son más estables que las secuencias con bajo contenido de GC, pero, contrariamente a la creencia popular, los enlaces de hidrógeno no son la razón principal de esta estabilidad. La estabilización se debe principalmente a interacciones de apilamiento llamadas apilamiento de bases. Hay una hermosa bioquímica y biofísica detrás de esto y, si está interesado, hay una explicación fantástica de por qué ocurre este apilamiento.

¡Hecho de la diversión! Esta es la razón por Thermus thermophilus, un extremófilo, tiene un genoma rico en GC, también regiones de nuestro genoma (asumiendo, por supuesto, que eres humano) que necesitan ser transcritas muy a menudo, como las regiones promotoras de un gen transcrito popularmente, son ricas en AT, como la caja TATA - ordenado, ¿eh?

Problema 2. Formación de estructuras secundarias

Este punto está muy ligado al primer punto. Cuando las regiones ricas en GC forman estructuras secundarias, particularmente bucles de horquilla, son muy estables y, por lo tanto, se quedan y se acumulan. Estos no se derriten bien a las temperaturas habituales de desnaturalización de la PCR. Además, los cebadores utilizados para amplificar regiones ricas en GC tienden a formar dímeros propios y cruzados, así como estructuras de tallo en bucle que pueden impedir el progreso de la ADN polimerasa a lo largo de la molécula molde que conduce a productos de PCR truncados. Las secuencias ricas en GC en el extremo 3 'de los cebadores también pueden provocar un cebado incorrecto.

¡Maricón! * los sonidos de su confianza en su capacidad para desinflar la PCR *

¡Pero espera! ¡Tenemos algunas soluciones para ti!

Solución 1. Aumento de la temperatura de fusión

Esta es una solución muy sensible (en teoría). Cuanto mayor sea la temperatura, más probable es que se separen esas molestas estructuras secundarias formadas por regiones ricas en GC. Sin embargo, esto da como resultado rendimientos de producto más bajos, ya que su taq comienza a desnaturalizarse más rápidamente a temperaturas superiores a 92,5 ° C, por lo que es aconsejable utilizar solo temperaturas de fusión más altas durante los primeros ciclos y evitar superar los 95 ° C. Puede que sea necesario jugar un poco, pero esta solución es un buen punto de partida.

Solución 2. Ajuste de su concentración de magnesio

La amplificación inespecífica en general puede exacerbarse e incluso ser causada por el uso de concentraciones excesivas de magnesio (Mg), por lo tanto, pruebe la concentración óptima usando PCR de gradiente o titulación. En pocas palabras, su pozo de la izquierda absoluta contiene menos de lo que cree que funcionará y su pozo de la derecha absoluta contiene una cantidad excesiva de magnesio con un gradiente en el medio para que pueda determinar la cantidad más baja posible que puede usar para lograr su producto.

Solución 3. Llamar a un amigo:

Encontré algunas recetas en línea que varios laboratorios han encontrado que funcionan bien para ellos:

  1. Adición de 3-10% de dimetilsulfóxido (DMSO), más a menudo 5%
  2. La adición de betaína 1M y DMSO al 5% & # 8211 pueden reducir la actividad de su enzima, así que agregue enzima adicional
  3. Adición de betaína (Sigma), DMSO, DTT y BSA
  4. Adición de etilenglicol con 1,2-propanodiol
  5. Adición de DMSO al 5% y formamida al 1,25% o simplemente formamida
  6. Adición de 5 & # 8211 10% de glicerol absoluto y mayor temperatura de recocido
  7. Use HotStart regular y agregue betaína 2M
  8. Utilice la enzima Kapa & # 8217s HiFi Hot Start
  9. Utilice el kit rico en KAPA3G GC con 5% de DMSO
  10. Los potenciadores GC disponibles en varios kits como este, Clontech, Epicenter y Qiagen también ofrecen kits para este problema si tiene algo de dinero de sobra.

Algunas de estas opciones están bellamente resumidas con enlaces a referencias aquí. También tenemos una publicación que detalla los diferentes aditivos de PCR y cómo pueden ayudarlo.

Solución 4. Otros tipos de PCR

  1. Nested-PCR: He escrito completamente sobre esta técnica, ¡así que estad atentos a eso!
  2. Slowdown-PCR: explorado aquí.
  3. PCR de inicio en caliente.
  4. PCR de largo alcance: clontech y qiagen ofrecen kits para este problema si tiene algo de dinero de sobra.

Estas formas de PCR y más se describen aquí de forma simple y breve.

¡Tienes un montón de opciones! Háganos saber qué le ha funcionado en los comentarios a continuación.

Apilamiento de bases: Kool ET. (2001) Enlace de hidrógeno, apilamiento de bases y efectos estéricos en la replicación del ADN. Annu Rev Biophys Biomol Struct. 30:1–22.

Etilenglicol con 1,2-propanodiol: Zhizhou, Z. et al. (2009) Amplificación mejorada de ADN rico en GC con dos reactivos orgánicos. BioTécnicas 47.3: 775-79. Web

Usando formamida en PCR: Sarkar, G., et al. (1990). La formamida puede mejorar drásticamente la especificidad de la PCR. Investigación de ácidos nucleicos, 7465-7465.


Asamblea Golden Gate

Golden Gate Assembly utiliza dos enzimas de restricción de tipo IIS, que cortan el ADN fuera del sitio de reconocimiento real de la enzima. Los sitios de reconocimiento están separados por al menos un par de bases de la secuencia que sobresale, lo que garantiza que no se produzcan cicatrices en la secuencia de ADN porque la secuencia que sobresale no está dictada por la enzima de restricción. Si la secuencia de reconocimiento no es palindrómica, puede ensamblar varios fragmentos al mismo tiempo y de manera ordenada. Además, debido a que el sitio de restricción se altera durante la reacción, la digestión y la ligadura pueden ocurrir en un tubo, al mismo tiempo. Por lo tanto, este método a menudo se considera una "maravilla de una olla".

El proceso de ligadura Golden Gate es casi 100% eficiente gracias a los mecanismos de re-digestión. Además, se evita la nueva ligadura, porque la escisión fuera de los sitios de las enzimas de restricción los elimina del producto. Sin embargo, puede encontrar que diseñar las secuencias de voladizo correctas puede ser tedioso, y Golden Gate Assembly es mucho menos independiente de la secuencia que otros métodos de clonación. A pesar de estas limitaciones, Golden Gate Assembly es particularmente bueno para construir bibliotecas combinatorias en las que cada fragmento está flanqueado por las mismas dos secuencias salientes.


Generación de vectores plasmídicos que expresan proteínas marcadas con FLAG bajo la regulación del promotor del factor de elongación 1α humano usando ensamblaje de Gibson

La clonación por ensamblaje de Gibson (GA) ofrece una alternativa rápida, confiable y flexible a los métodos convencionales de clonación de ADN. Usamos GA para crear plásmidos personalizados para la expresión de genes exógenos en células madre embrionarias de ratón (mESC). La expresión de genes exógenos bajo el control del SV40 o de los promotores del citomegalovirus humano disminuye rápidamente después de la transfección en mESC. Un remedio para esta expresión disminuida es utilizar el promotor alfa del factor de elongación humano 1 (hEF1α) para impulsar la expresión génica. Los vectores plásmidos que contienen hEF1α no están tan ampliamente disponibles como los plásmidos que contienen SV40 o CMV, especialmente aquellos que también contienen etiquetas 3xFLAG N-terminales. El protocolo descrito aquí es un método rápido para crear plásmidos que expresan el mutante CstF-64 y CstF-64 etiquetado con FLAG bajo la regulación expresiva del promotor hEF1α. GA utiliza una mezcla de ADN exonucleasa, ADN polimerasa y ADN ligasa para hacer posible la clonación de los extremos superpuestos de los fragmentos de ADN. Basándonos en las plantillas de ADN que teníamos disponibles, diseñamos nuestras construcciones para ensamblarlas en una sola secuencia. Nuestro diseño utilizó cuatro fragmentos de ADN: columna vertebral del vector pcDNA 3.1, parte 1 del promotor hEF1α, parte 2 del promotor hEF1α (que contenía etiqueta 3xFLAG comprada como un fragmento de ADN sintético de doble hebra) y CstF-64 o mutante específico de CstF-64. Las secuencias de estos fragmentos se cargaron en una herramienta de generación de cebadores para diseñar cebadores de PCR apropiados para generar los fragmentos de ADN. Después de la PCR, los fragmentos de ADN se mezclaron con el vector que contenía el marcador selectivo y se ensambló la reacción de clonación de GA. Se aislaron plásmidos de colonias bacterianas transformadas individuales. El cribado inicial de los plásmidos se realizó mediante digestión de restricción, seguido de secuenciación. En conclusión, GA nos permitió crear plásmidos personalizados para la expresión génica en 5 días, incluidas las pantallas de construcción y la verificación.


Ensamblaje de Gibson - diseño de imprimación con regiones ricas en A y T - Biología

Simulador de diseñador de clonación molecular

Una nueva plataforma todo en uno de diseño, simulación y gestión de clonación molecular con un diseño de diagrama de flujo único.

Consulte esta publicación si utilizó MCDS en su investigación: http://dx.doi.org/10.1016/j.meteno.2016.05.003

Abstracto: Con el desarrollo de la biología sintética, las manipulaciones del ADN se vuelven cada vez más complejas. Aunque se encuentran disponibles varios programas de software para el diseño de clonación molecular, todos adolecen de inconvenientes en el contexto de la gestión de los complejos procesos de clonación y modificación genética que ahora son rutinarios en la biología molecular moderna. Para abordar las limitaciones actuales, desarrollamos una nueva y poderosa plataforma de software todo en uno que permite el diseño, la simulación y la gestión a nivel de proyecto, con una nueva interfaz de usuario de diagrama de flujo interactivo. Además de las funciones estándar, tiene una serie de características que son únicas o que no se encuentran en combinación en ningún paquete de software: (1) Tiene una interfaz de usuario de diagrama de flujo interactivo para procesos complejos de varios pasos, lo que permite una descripción general integrada de todo el proyecto (2) Puede realizar un flujo de trabajo de pasos de clonación definido por el usuario en una sola ejecución del software (3) Puede manejar múltiples tipos de recombinación genética, una técnica que está reemplazando rápidamente la clonación clásica para muchas aplicaciones y (4) incluye información experimental para guiar convenientemente el trabajo de laboratorio húmedo y puede almacenar resultados y comentarios para permitir el seguimiento y la gestión de todo el proyecto en una plataforma. MCDS puede diseñar, simular, gestionar y registrar la mayoría de las técnicas de clonación en clonación molecular general, ingeniería genética y biología sintética, incluida la tecnología de ADN recombinante, SLIC (clonación independiente de secuencia y ligadura), Golden Gate, clonación de puerta de enlace, ensamblaje isotérmico de Gibson, recombinación homóloga de levadura para ensamblaje de ADN, recombinación específica de sitio e integración cromosómica, ensamblaje PhiC31, knock-out / knock-in de Lambda Red y digestión CRISPR. La organización del diagrama de flujo permite un seguimiento y una gestión sencillos de esos experimentos complejos.

.Net Framework 4.6 debe estar instalado antes de ejecutar MCDS (si está utilizando Windows 8 o inferior).


Fondo

La levadura Pichia pastoris (sin. Komagataella spp.) se aplica con frecuencia para la producción de proteínas heterólogas, la mayoría de las cuales se secretan eficazmente [1]. También es favorecido para la producción de proteínas de membrana [2], productos farmacéuticos y compuestos químicos [3] y como organismo modelo para la investigación biomédica [4]. Nuevas herramientas genéticas para P. pastoris tales como promotores, péptidos señal, marcadores de selección, recombinación Flp-frt / Cre-lox y CRISPR / Cas9 han sido revisados ​​recientemente [3]. En comparación con otras especies de levaduras, P. pastoris se distingue por su metilotrofia, su metabolismo negativo de Crabtree, su crecimiento a densidades celulares muy altas, el bajo número y concentración de proteínas secretadas de la célula huésped [5] y la disponibilidad de muchas herramientas genéticas y cepas de relevancia industrial (N-glicosilación humanizada, deficiencia de proteasa) [6]. La integración genómica en loci específicos se aplica generalmente mediante el uso de regiones homólogas 5 'y 3' y depende fundamentalmente de la evitación de regiones homólogas repetitivas y del uso de ADN de vector bien purificado [7].

Para la producción de proteínas recombinantes en P. pastoris, se establecieron diferentes sistemas de promotores altamente eficientes (revisados ​​por Weinhandl et al. [8]) y se aplicaron para producir hasta varios gramos por litro de productos heterólogos secretados, que cubren proteínas destinadas a fines biofarmacéuticos y enzimas industriales [9]. La vía de utilización de metanol (MUT) de P. pastoris es muy eficiente y los genes correspondientes están altamente inducidos en metanol [10, 11]. Promotores MUT (p. Ej. PAG AOX1, PAG DAS1 / 2 y PAG FLD1) así como fuertes promotores constitutivos de genes altamente expresados ​​(como PAG BRECHA, derivado del gen de la gliceraldehído-3-fosfato deshidrogenasa TDH3 y el promotor del factor de elongación de la traducción PAG TEF1) se aplican con frecuencia [12]. No obstante, todavía hay margen para mejorar aún más la productividad y / o la calidad de las proteínas. Además de aumentar la fuerza transcripcional mediante el uso de promotores fuertes y un mayor número de copias de genes de los casetes de expresión, también la ingeniería celular para aumentar la capacidad de secreción y plegamiento del huésped o para proporcionar precursores y energía para estos procesos demostró ser beneficiosa para mejorar los títulos de productos (revisado por Puxbaum et al. [1]). A veces, estos enfoques de ingeniería celular requieren la sobreexpresión simultánea de más de un gen para alcanzar su máximo potencial (por ejemplo, Nocon et al. [13], Delic et al. [14]). Por otro lado, la eliminación de genes podría ser necesaria para evitar procesos perjudiciales como el transporte a la vacuola o la proteólisis (por ejemplo, Idiris et al. [15]). Ambas manipulaciones genéticas requieren extensos esfuerzos de clonación y transformación, lo que las hace bastante tediosas y tediosas.

Hoy en día, las herramientas avanzadas de biología sintética se aplican en todos los campos de la microbiología. Los nuevos métodos de clonación, como Gateway®, Gibson Assembly y Golden Gate, junto con técnicas de edición del genoma como CRISPR / Cas9 y TALEN (nucleasas efectoras de tipo activador de la transcripción), permiten una ingeniería celular eficiente y altamente específica y, por lo tanto, revolucionaron todo el campo [16 ]. La clonación de Golden Gate se basa en las enzimas de restricción de tipo II (que se cortan fuera de su secuencia de reconocimiento) y ofrece importantes beneficios: no requiere un ADN flanqueante largo, utiliza reacciones eficientes en un solo recipiente, permite la clonación sin cicatrices y es costosa. ahorro en comparación con muchas otras técnicas avanzadas [17]. En Golden Gate Assembly (GGA), las dos endonucleasas de restricción de tipo II diferentes Bsayo y BpiSe utilizan los que producen cuatro voladizos de pares de bases fuera de su secuencia de reconocimiento. Estos voladizos se pueden diseñar libremente y se denominan sitios de fusión (Fs). Estos sitios de fusión permiten el ensamblaje preciso de pares de bases de partes genéticas tales como promotores, secuencias de codificación (CDS) y terminadores de la transcripción. Mediante el uso de restricción y ligación simultáneas en reacciones de clonación en un solo recipiente, se logra un ensamblaje rápido de múltiples fragmentos de ADN [17].

Recientemente, Obst et al. [18] y Schreiber et al. [19] informó sobre el uso de la clonación Golden Gate para la generación de bibliotecas de casetes de expresión en P. pastoris, que fueron probados para la producción de proteínas informadoras mediante el ensamblaje de partes estandarizadas como promotores, sitios de unión de ribosomas, señales de secreción y terminadores de una manera rápida y eficiente. Estos estudios tenían como objetivo optimizar una única unidad de transcripción para la producción de una proteína heteróloga de interés (un indicador fluorescente o un péptido antimicrobiano). Vogl y col. [20] utilizó ensamblaje de Gibson con un conjunto de promotores relacionados con MUT y nuevos terminadores de la transcripción para la sobreexpresión de múltiples genes en P. pastoris y podría mostrar un fuerte efecto de los promotores insertados al sobreexpresar la vía de los carotenoides (crtE, crtB, crtI y crtY). Nuestro estudio extiende la versátil técnica Golden Gate para todas las aplicaciones en P. pastoris donde se requiere la integración simultánea de múltiples productos de ADN (por ejemplo, ingeniería celular, vía de expresión, producción de proteínas, coexpresión de cofactores) y apunta más allá del mero ensamblaje de casetes de expresión únicos para la proteína heteróloga de interés.

Para ello, adaptamos la clonación modular basada en Golden Gate (MoClo) introducida por Weber et al. [21], para crear el GoldenPiCS (derivado de Golden Gate P. pastoris sistema de clonación) kit de herramientas de vectores. doradoPiCS es parte de un sistema universal denominado GoldenMOCS, que significa Sistema de clonación de organismos múltiples derivado de Golden Gate [22]. La plataforma GoldenMOCS permite la integración versátil de partes específicas del huésped, como promotores, terminadores y casetes de resistencia, orígenes de replicación o loci de integración del genoma para adaptar el plásmido a las necesidades del experimento y la célula huésped que se va a diseñar. A continuación, presentamos el subsistema GoldenMOCS- GoldenPiCS diseñado para su uso en P. pastoris y la caracterización de sus partes genéticas individuales utilizando eGFP (proteína de fluorescencia verde mejorada) como reportero. Los vectores de estos sistemas se depositaron en Addgene como GoldenPiKit CS (# 1000000133).


Presentamos el diseño, la síntesis y el ensamblaje del par de megabase de 1.08 Mycoplasma mycoides JCVI-syn1.0 genoma a partir de la información de la secuencia del genoma digitalizada y su trasplante en un M. capricolum celda receptora para crear una nueva M. mycoides células que están controladas solo por el cromosoma sintético. El único ADN en las células es la secuencia de ADN sintética diseñada, incluidas las secuencias de "marca de agua" y otras deleciones y polimorfismos de genes diseñados, y mutaciones adquiridas durante el proceso de construcción. Las nuevas células tienen propiedades fenotípicas esperadas y son capaces de autorreplicarse continuamente.

En 1977, Sanger y sus colegas determinaron la secuencia genética completa del fago ϕX174 (1), el primer genoma de ADN en ser completamente secuenciado. Dieciocho años después, en 1995, nuestro equipo pudo leer la primera secuencia genética completa de una bacteria autorreplicante, Haemophilus influenzae (2). La lectura de la secuencia genética de una amplia gama de especies ha aumentado exponencialmente a partir de estos primeros estudios. La capacidad de digitalizar rápidamente la información genómica ha aumentado en más de ocho órdenes de magnitud durante los últimos 25 años (3). Los esfuerzos para comprender toda esta nueva información genómica han generado numerosos paradigmas experimentales y computacionales nuevos, pero nuestro conocimiento genómico sigue siendo muy limitado. Ningún sistema celular tiene todos sus genes entendidos en términos de sus roles biológicos. Incluso en células bacterianas simples, ¿contienen los cromosomas todo el repertorio genético? Si es así, ¿se puede reproducir un sistema genético completo mediante síntesis química comenzando solo con la secuencia de ADN digitalizada contenida en una computadora?

Nuestro interés en la síntesis de grandes moléculas de ADN y cromosomas surgió de nuestros esfuerzos durante los últimos 15 años para construir una célula mínima que contenga solo genes esenciales. Este trabajo fue inaugurado en 1995 cuando secuenciamos el genoma de Mycoplasma genitalium, una bacteria con el complemento de genes más pequeño de cualquier organismo conocido capaz de crecer de forma independiente en el laboratorio. Más de 100 de los 485 genes codificadores de proteínas de M. genitalium son prescindibles cuando se interrumpen uno a la vez (46).

Desarrollamos una estrategia para ensamblar piezas de tamaño viral para producir grandes moléculas de ADN que nos permitieron ensamblar un material sintético. M. genitalium genoma en cuatro etapas a partir de casetes de ADN sintetizados químicamente con un tamaño promedio de aproximadamente 6 kb. Esto se logró mediante una combinación de métodos enzimáticos in vitro y recombinación in vivo en Saccharomyces cerevisiae. Todo el genoma sintético [582,970 pares de bases (pb)] se cultivó de manera estable como un plásmido centromérico de levadura (YCp) (7).

Se superaron varios obstáculos al trasplantar y expresar un cromosoma sintetizado químicamente en una célula receptora. Necesitábamos mejorar los métodos para extraer cromosomas intactos de la levadura. También necesitábamos aprender a trasplantar estos genomas en una célula bacteriana receptora para establecer una célula controlada solo por un genoma sintético. Porque M. genitalium tiene una tasa de crecimiento extremadamente lenta, recurrimos a dos especies de micoplasmas de crecimiento más rápido, M. mycoides subespecie capri (GM12) como donante, y M. capricolum subespecie capricolum (CK) como destinatario.

Para establecer las condiciones y los procedimientos para trasplantar el genoma sintético de la levadura, desarrollamos métodos para clonar cromosomas bacterianos completos como plásmidos centroméricos en levadura, incluido un nativo. M. mycoides el genoma8, 9). Sin embargo, los intentos iniciales de extraer el M. mycoides genoma de levadura y trasplantarlo a M. capricolum fallido. Descubrimos que los micoplasmas del donante y el receptor comparten un sistema de restricción común. El genoma del donante fue metilado en el nativo M. mycoides células y, por lo tanto, estaba protegido contra la restricción durante el trasplante de una célula donante nativa (10). Sin embargo, los genomas bacterianos cultivados en levadura no están metilados y, por lo tanto, no están protegidos del sistema de restricción único de la célula receptora. Superamos esta barrera de restricción metilando el ADN del donante con metilasas purificadas o crudas. M. mycoides o M. capricolum extractos, o simplemente interrumpiendo el sistema de restricción de la célula receptora (8).

Ahora hemos combinado todos nuestros procedimientos previamente establecidos e informamos la síntesis, el ensamblaje, la clonación y el trasplante exitoso del 1.08-Mbp M. mycoides JCVI-syn1.0 genoma, para crear una nueva célula controlada por este genoma sintético.

Diseño de genoma sintético. Diseño del M. mycoides El genoma de JCVI-syn1.0 se basó en las secuencias genómicas terminadas de alta precisión de dos cepas de laboratorio de M. mycoides subespecie capri GM12 (8, 9, 11). Uno fue el donante de genoma utilizado por Lartigue et al. [Adhesión de GenBank CP001621] (10). La otra era una cepa creada mediante el trasplante de un genoma que había sido clonado y diseñado en levadura, YCpMmyc1.1-ΔtypeIIIres [Adhesión de GenBank CP001668] (8). Este proyecto dependía críticamente de la precisión de estas secuencias. Aunque creemos que ambos terminaron M. mycoides Las secuencias del genoma son fiables, hay 95 sitios en los que difieren. Comenzamos a diseñar el genoma sintético antes de que ambas secuencias estuvieran terminadas. En consecuencia, la mayoría de los casetes se diseñaron y sintetizaron basándose en la secuencia CP001621 (11). Cuando estuvo terminado, elegimos la secuencia del genoma trasplantado con éxito de levadura (CP001668) como nuestra referencia de diseño (excepto que mantuvimos intacta la typeIIIres gene). Todas las diferencias que parecían biológicamente significativas entre CP001668 y casetes sintetizados previamente se corrigieron para que coincidieran exactamente (11). Las diferencias de secuencia entre nuestros casetes sintéticos y CP001668 que ocurrieron en 19 sitios parecían inofensivas y, por lo tanto, no se corrigieron. Estos proporcionan 19 diferencias polimórficas entre nuestro genoma sintético (JCVI-syn1.0) y el genoma natural (no sintético) (YCpMmyc1.1) que hemos clonado en levadura y usamos como estándar para el trasplante de genoma de levadura (8). Para diferenciar aún más entre el genoma sintético y el natural, diseñamos cuatro secuencias de marca de agua (fig. S1) para reemplazar uno o más casetes en regiones demostradas experimentalmente [marcas de agua 1 (1246 pb) y 2 (1081 pb)] o predichas [marcas de agua 3 (1109 pb) y 4 (1222 pb)] para no interferir con la viabilidad celular. Estas secuencias de marca de agua codifican identificadores únicos al tiempo que limitan su traducción a péptidos. La Tabla S1 enumera las diferencias entre el genoma sintético y este estándar natural. La figura S2 muestra un mapa de la M. mycoides Genoma de JCVI-syn1.0. Límites intermedios de casete y ensamblaje, marcas de agua, deleciones, inserciones y genes del M. mycoides JCVI syn1.0 se muestran en la fig. S2, y la secuencia del clon de micoplasma trasplantado sMmYCp235-1 se ha enviado a GenBank (acceso CP002027).

Estrategia de ensamblaje del genoma sintético. Los casetes diseñados eran generalmente de 1080 bp con superposiciones de 80 bp con los casetes adyacentes (11). Todos fueron producidos por ensamblaje de oligonucleótidos sintetizados químicamente por Blue Heron (Bothell, Washington). El fabricante sintetizó y verificó la secuencia de cada casete individualmente. Para ayudar en el proceso de construcción, se diseñaron casetes de ADN e intermedios de ensamblaje para contener sitios de restricción Not I en sus extremos y se recombinaron en presencia de elementos vectoriales para permitir el crecimiento y la selección en levadura (7, 11). Se diseñó una estrategia jerárquica para ensamblar el genoma en tres etapas mediante transformación y recombinación homóloga en levadura de 1078 casetes de 1 kb (Fig.1) (12, 13).

El montaje de un sintético M. mycoides genoma en levadura. Un sintético M. mycoides El genoma se ensambló a partir de 1078 casetes de ADN superpuestos en tres pasos. En el primer paso, se recombinaron casetes de 1080 pb (flechas naranjas), producidos a partir de oligonucleótidos sintéticos superpuestos, en conjuntos de 10 para producir 109

Conjuntos de 10 kb (flechas azules). Estos luego se recombinaron en conjuntos de 10 para producir 11

Conjuntos de 100 kb (flechas verdes). En la etapa final de ensamblaje, estos 11 fragmentos se recombinaron en el genoma completo (círculo rojo). Con la excepción de dos construcciones que se ensamblaron enzimáticamente in vitro (27) (flechas blancas), los ensamblajes se llevaron a cabo mediante recombinación homóloga in vivo en levadura. Las principales variaciones del genoma natural se muestran como círculos amarillos. Estos incluyen cuatro regiones con marca de agua (WM1 a WM4), una región de 4 kb que se eliminó intencionalmente (94D) y elementos para el crecimiento en el trasplante de levadura y genoma. Además, hay 20 ubicaciones con polimorfismos de nucleótidos (asteriscos). Las coordenadas del genoma son relativas al primer nucleótido del natural. M. mycoides secuencia. La secuencia diseñada es de 1.077.947 pb. Se muestran las ubicaciones de los sitios de restricción Asc I y BssH II. Los casetes 1 y 800-810 fueron innecesarios y se eliminaron de la estrategia de ensamblaje (11). El casete 2 se superpone al casete 1104 y el casete 799 se superpone al casete 811.

Ensamblaje de intermedios sintéticos de 10 kb. En la primera etapa, se recombinaron casetes y un vector en levadura y se transfirieron a Escherichia coli (11). A continuación, se aisló el ADN plasmídico del individuo E. coli clones y digeridos para cribar células que contienen un vector con un inserto ensamblado de 10 kb. Se representa un ensamblaje exitoso de 10 kb (Fig. 2A). En general, podría obtenerse al menos un fragmento ensamblado de 10 kb seleccionando 10 clones de levadura. Sin embargo, la tasa de éxito varió del 10 al 100%. Se secuenciaron todos los intermedios de la primera etapa. Diecinueve de los 111 ensamblajes contenían errores. Se seleccionaron clones alternativos, se verificó la secuencia y se pasaron a la siguiente etapa de ensamblaje (11).

Análisis de los intermedios de montaje. (A) Análisis de digestión de doble restricción no I y Sbf I del conjunto 341-350 purificado de E. coli. Estas enzimas de restricción liberan los fragmentos de vector (5,5 y 3,4 kb) del inserto de 10 kb. El ADN del inserto se separó del ADN del vector en un gel E al 0,8% (Invitrogen). M indica la escalera de ADN de 1 kb (New England Biolabs NEB). (B) Análisis del ensamblaje 501-600 purificado a partir de levadura. Los círculos de 105 kb (inserto de 100 kb más vector de 5 kb) se separaron del ADN cromosómico de levadura lineal en un gel de agarosa al 1% aplicando 4,5 V / cm durante 3 horas. S indica la escalera de ADN superenrollado BAC-Tracker (epicentro). (C) No I análisis de digestión de restricción de los 11

Ensambles de 100 kb purificados a partir de levadura. Estos fragmentos de ADN se analizaron mediante FIGE en un gel de agarosa al 1%. Se indica el tamaño de plaquita esperado para cada conjunto. λ indica la escalera lambda (NEB). (D) Análisis de los 11 conjuntos agrupados que se muestran en (C) tras la captura topológica del ADN circular y la digestión con Not I. Está representada una cuadragésima parte del ADN utilizado para transformar la levadura.

Ensamblaje de intermedios sintéticos de 100 kb. Los ensamblajes de 10 kb agrupados y sus respectivos vectores de clonación se transformaron en levadura como se indicó anteriormente para producir intermedios de ensamblaje de 100 kb (11). Nuestros resultados indicaron que estos productos no se pueden mantener de manera estable en E. coli, por lo que el ADN recombinado tuvo que extraerse de la levadura. La reacción en cadena de la polimerasa múltiple (PCR) se realizó en clones de levadura seleccionados (figura S3 y tabla S2). Debido a que cada intermedio de ensamblaje de 10 kb estaba representado por un par de cebadores en este análisis, la presencia de todos los amplicones sugeriría un intermedio ensamblado de 100 kb. En general, el 25% o más de los clones seleccionados contenían todos los amplicones esperados para un ensamblaje completo. Se seleccionó uno de estos clones para un cribado adicional. El ADN plasmídico circular se extrajo y se dimensionó en un gel de agarosa junto con un marcador superenrollado. Los ensamblajes de segunda etapa exitosos con la secuencia vectorial son

105 kb de longitud (Fig. 2B). Cuando todos los amplicones se producían después de la PCR multiplex, normalmente se producía un intermedio de ensamblaje de segunda etapa del tamaño correcto. En algunos casos, sin embargo, se produjeron pequeñas eliminaciones. En otros casos, se ensamblaron múltiples fragmentos de 10 kb, lo que produjo un intermedio de ensamblaje de segunda etapa más grande. Afortunadamente, estas diferencias podrían detectarse fácilmente en un gel de agarosa antes del ensamblaje completo del genoma.

Ensamblaje completo del genoma. En preparación para la etapa final de ensamblaje, fue necesario aislar cantidades de microgramos de cada uno de los 11 ensamblajes de la segunda etapa (11). Como se informó (14), los plásmidos circulares del tamaño de nuestros ensamblajes de segunda etapa podrían aislarse de esferoplastos de levadura después de un procedimiento de lisis alcalina. Para purificar aún más los 11 intermedios de ensamblaje, se trataron con exonucleasa y se pasaron a través de una columna de intercambio aniónico. Una pequeña fracción del ADN plasmídico total (1/100) se digirió con Not I y se analizó mediante electroforesis en gel de inversión de campo (FIGE) (Fig. 2C). Este método produjo

1 μg de cada conjunto por 400 ml de cultivo de levadura (

The method above does not completely remove all of the linear yeast chromosomal DNA, which we found could substantially decrease the yeast transformation and assembly efficiency. To further enrich for the 11 circular assembly intermediates,

200 ng samples of each assembly were pooled and mixed with molten agarose. As the agarose solidifies, the fibers thread through and topologically “trap” circular DNA (15). Untrapped linear DNA can then be separated out of the agarose plug by electrophoresis, thus enriching for the trapped circular molecules. The 11 circular assembly intermediates were digested with Not I so that the inserts could be released. Subsequently, the fragments were extracted from the agarose plug, analyzed by FIGE (Fig. 2D), and transformed into yeast spheroplasts (11). In this third and final stage of assembly, an additional vector sequence was not required because the yeast cloning elements were already present in assembly 811-900.

To screen for a complete genome, multiplex PCR was carried out with 11 primer pairs, designed to span each of the 11 100-kb assembly junctions (table S3). Of 48 colonies screened, DNA extracted from one clone (sMmYCp235) produced all 11 amplicons. PCR of the wild-type positive control (YCpMmyc1.1) produced an indistinguishable set of 11 amplicons (Fig. 3A). To further demonstrate the complete assembly of a synthetic M. mycoides genome, intact DNA was isolated from yeast in agarose plugs and subjected to two restriction analyses: Asc I and BssH II (11). Because these restriction sites are present in three of the four watermark sequences, this choice of digestion produces restriction patterns that are distinct from that of the natural M. mycoides genome (Figs. 1 and 3B). The sMmYCp235 clone produced the restriction pattern expected for a completely assembled synthetic genome (Fig. 3C).

Characterization of the synthetic genome isolated from yeast. (A) Yeast clones containing a completely assembled synthetic genome were screened by multiplex PCR with a primer set that produces 11 amplicons one at each of the 11 assembly junctions. Yeast clone sMmYCp235 (235) produced the 11 PCR products expected for a complete genome assembly. For comparison, the natural genome extracted from yeast (WT, wild type) was also analyzed. PCR products were separated on a 2% E-gel (Invitrogen). L indicates the 100-bp ladder (NEB). (B) The sizes of the expected Asc I and BssH II restriction fragments for natural (WT) and synthetic (Syn235) M. mycoides genomas. (C) Natural (WT) and synthetic (235) M. mycoides genomes were isolated from yeast in agarose plugs. In addition, DNA was purified from the host strain alone (H). Agarose plugs were digested with Asc I or BssH II, and fragments were separated by clamped homogeneous electrical field (CHEF) gel electrophoresis. Restriction fragments corresponding to the correct sizes are indicated by the fragment numbers shown in (B).

Synthetic genome transplantation. Additional agarose plugs used in the gel analysis above (Fig. 3C) were also used in genome transplantation experiments (11). Intact synthetic M. mycoides genomes from the sMmYCp235 yeast clone were transplanted into restriction-minus M. capricolum recipient cells, as described (8). Results were scored by selecting for growth of blue colonies on SP4 medium containing tetracycline and X-gal at 37°C. Genomes isolated from this yeast clone produced 5 to 15 tetracycline-resistant blue colonies per agarose plug, a number comparable to that produced by the YCpMmyc1.1 control. Recovery of colonies in all transplantation experiments was dependent on the presence of both M. capricolum recipient cells and an M. mycoides genoma.

Semisynthetic genome assembly and transplantation. To aid in testing the functionality of each 100-kb synthetic segment, semisynthetic genomes were constructed and transplanted. By mixing natural pieces with synthetic ones, the successful construction of each synthetic 100-kb assembly could be verified without having to sequence these intermediates. We cloned 11 overlapping natural 100-kb assemblies in yeast by using a previously described method (16). In 11 parallel reactions, yeast cells were cotransformed with fragmented M. mycoides genomic DNA (YCpMmyc 1.1) that averaged

100 kb in length and a PCR-amplified vector designed to overlap the ends of the 100-kb inserts. To maintain the appropriate overlaps so that natural and synthetic fragments could be recombined, the PCR-amplified vectors were produced via primers with the same 40-bp overlaps used to clone the 100-kb synthetic assemblies. The semisynthetic genomes that were constructed contained between 2 and 10 of the 11 100-kb synthetic subassemblies (Table 1). The production of viable colonies produced after transplantation confirmed that the synthetic fraction of each genome contained no lethal mutations. Only one of the 100-kb subassemblies, 811-900, was not viable.

Genomes that have been assembled from 11 pieces and successfully transplanted. Assembly 2-100, 1 assembly 101-200, 2 assembly 201-300, 3 assembly 301-400, 4 assembly 401-500, 5 assembly 501-600, 6 assembly 601-700, 7 assembly 701-799, 8 assembly 811-900, 9 assembly 901-1000, 10 assembly 1001-1104, 11. WM, watermarked assembly.

Initially, an error-containing 811-820 clone was used to produce a synthetic genome that did not transplant. This was expected because the error was a single–base pair deletion that creates a frameshift in dnaA, an essential gene for chromosomal replication. We were previously unaware of this mutation. By using a semisynthetic genome construction strategy, we pinpointed 811-900 as the source for failed synthetic transplantation experiments. Thus, we began to reassemble an error-free 811-900 assembly, which was used to produce the sMmYCp235 yeast strain. los dnaA-mutated genome differs by only one nucleotide from the synthetic genome in sMmYCp235. This genome served as a negative control in our transplantation experiments. los dnaA mutation was also repaired at the 811-900 level by genome engineering in yeast (17). A repaired 811-900 assembly was used in a final-stage assembly to produce a yeast clone with a repaired genome. This yeast clone is named sMmYCP142 and could be transplanted. A complete list of genomes that have been assembled from 11 pieces and successfully transplanted is provided in Table 1.

Characterization of the synthetic transplants. To rapidly distinguish the synthetic transplants from M. capricolum or natural M. mycoides, two analyses were performed. First, four primer pairs that are specific to each of the four watermarks were designed such that they produce four amplicons in a single multiplex PCR reaction (table S4). All four amplicons were produced by transplants generated from sMmYCp235, but not YCpMmyc1.1 (Fig. 4A). Second, the gel analysis with Asc I and BssH II, described above (Fig. 3C), was performed. The restriction pattern obtained was consistent with a transplant produced from a synthetic M. mycoides genome (Fig. 4B).

Characterization of the transplants. (A) Transplants containing a synthetic genome were screened by multiplex PCR with a primer set that produces four amplicons, one internal to each of the four watermarks. One transplant (syn1.0) originating from yeast clone sMmYCp235 was analyzed alongside a natural, nonsynthetic genome (WT) transplanted out of yeast. The transplant containing the synthetic genome produced the four PCR products, whereas the WT genome did not produce any. PCR products were separated on a 2% E-gel (Invitrogen). (B) Natural (WT) and synthetic (syn1.0) M. mycoides genomes were isolated from M. mycoides transplants in agarose plugs. Agarose plugs were digested with Asc I or BssH II and fragments were separated by CHEF gel electrophoresis. Restriction fragments corresponding to the correct sizes are indicated by the fragment numbers shown in Fig. 3B.

A single transplant originating from the sMmYCp235 synthetic genome was sequenced. We refer to this strain as M. mycoides JCVI-syn1.0. The sequence matched the intended design with the exception of the known polymorphisms, eight new single-nucleotide polymorphisms, an E. coli transposon insertion, and an 85-bp duplication (table S1). The transposon insertion exactly matches the size and sequence of IS1, a transposon in E. coli. It is likely that IS1 infected the 10-kb subassembly following its transfer to E. coli. The IS1 insert is flanked by direct repeats of M. mycoides sequence, suggesting that it was inserted by a transposition mechanism. The 85-bp duplication is a result of a nonhomologous end joining event, which was not detected in our sequence analysis at the 10-kb stage. These two insertions disrupt two genes that are evidently nonessential. We did not find any sequences in the synthetic genome that could be identified as belonging to M. capricolum. This indicates that there was a complete replacement of the M. capricolum genome by our synthetic genome during the transplant process.

The cells with only the synthetic genome are self-replicating and capable of logarithmic growth. Scanning and transmission electron micrographs (EMs) of M. mycoides JCVI-syn1.0 cells show small, ovoid cells surrounded by cytoplasmic membranes (Fig. 5, C to F). Proteomic analysis of M. mycoides JCVI-syn1.0 and the wild-type control (YCpMmyc1.1) by two-dimensional gel electrophoresis revealed almost identical patterns of protein spots (fig. S4) that differed from those previously reported for M. capricolum (10). Fourteen genes are deleted or disrupted in the M. mycoides JCVI-syn1.0 genome however, the rate of appearance of colonies on agar plates and the colony morphology are similar (compare Fig. 5, A and B). We did observe slight differences in the growth rates in a color-changing unit assay, with the JCVI-syn1.0 transplants growing slightly faster than the MmcyYCp1.1 control strain (fig. S6).

Images of M. mycoides JCVI-syn1.0 and WT M. mycoides. To compare the phenotype of the JCVI-syn1.0 and non-YCp WT strains, we examined colony morphology by plating cells on SP4 agar plates containing X-gal. Three days after plating, the JCVI-syn1.0 colonies are blue because the cells contain the lacZ gene and express β-galactosidase, which converts the X-gal to a blue compound (A). The WT cells do not contain lacZ and remain white (B). Both cell types have the fried egg colony morphology characteristic of most mycoplasmas. EMs were made of the JCVI-syn1.0 isolate using two methods. (C) For scanning EM, samples were postfixed in osmium tetroxide, dehydrated and critical point dried with CO2, and visualized with a Hitachi SU6600 SEM at 2.0 keV. (D) Negatively stained transmission EMs of dividing cells with 1% uranyl acetate on pure carbon substrate visualized using JEOL 1200EX CTEM at 80 keV. To examine cell morphology, we compared uranyl acetate–stained EMs of M. mycoides JCVI-syn1.0 cells (mi) with EMs of WT cells made in 2006 that were stained with ammonium molybdate (F). Both cell types show the same ovoid morphology and general appearance. EMs were provided by T. Deerinck and M. Ellisman of the National Center for Microscopy and Imaging Research at the University of California at San Diego.

Discussion. In 1995, the quality standard for sequencing was considered to be one error in 10,000 bp, and the sequencing of a microbial genome required months. Today, the accuracy is substantially higher. Genome coverage of 30 to 50× is not unusual, and sequencing only requires a few days. However, obtaining an error-free genome that could be transplanted into a recipient cell to create a new cell controlled only by the synthetic genome was complicated and required many quality-control steps. Our success was thwarted for many weeks by a single–base pair deletion in the essential gene dnaA. One wrong base out of more than 1 million in an essential gene rendered the genome inactive, whereas major genome insertions and deletions in nonessential parts of the genome had no observable effect on viability. The demonstration that our synthetic genome gives rise to transplants with the characteristics of M. mycoides cells implies that the DNA sequence on which it is based is accurate enough to specify a living cell with the appropriate properties.

Our synthetic genomic approach stands in sharp contrast to various other approaches to genome engineering that modify natural genomes by introducing multiple insertions, substitutions, or deletions (1822). This work provides a proof of principle for producing cells based on computer-designed genome sequences. DNA sequencing of a cellular genome allows storage of the genetic instructions for life as a digital file. The synthetic genome described here has only limited modifications from the naturally occurring M. mycoides genoma. However, the approach we have developed should be applicable to the synthesis and transplantation of more novel genomes as genome design progresses (23).

We refer to such a cell controlled by a genome assembled from chemically synthesized pieces of DNA as a “synthetic cell,” even though the cytoplasm of the recipient cell is not synthetic. Phenotypic effects of the recipient cytoplasm are diluted with protein turnover and as cells carrying only the transplanted genome replicate. Following transplantation and replication on a plate to form a colony (>30 divisions or >10 9 -fold dilution), progeny will not contain any protein molecules that were present in the original recipient cell (10, 24). This was previously demonstrated when we first described genome transplantation (10). The properties of the cells controlled by the assembled genome are expected to be the same as if the whole cell had been produced synthetically (the DNA software builds its own hardware).

The ability to produce synthetic cells renders it essential for researchers making synthetic DNA constructs and cells to clearly watermark their work to distinguish it from naturally occurring DNA and cells. We have watermarked the synthetic chromosome in this and our previous study (7).

If the methods described here can be generalized, design, synthesis, assembly, and transplantation of synthetic chromosomes will no longer be a barrier to the progress of synthetic biology. We expect that the cost of DNA synthesis will follow what has happened with DNA sequencing and continue to exponentially decrease. Lower synthesis costs combined with automation will enable broad applications for synthetic genomics.

We have been driving the ethical discussion concerning synthetic life from the earliest stages of this work (25, 26). As synthetic genomic applications expand, we anticipate that this work will continue to raise philosophical issues that have broad societal and ethical implications. We encourage the continued discourse.