Información

11.7: Endocitosis mediada por receptores - Biología

11.7: Endocitosis mediada por receptores - Biología



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Así como existe un tráfico vesicular hacia la membrana plasmática, ya sea por secreción o por incorporación de lípidos o proteínas de la membrana, también puede haber tráfico vesicular desde la membrana plasmática. A veces, la endocitosis se inicia internamente, tal vez para eliminar una proteína particular de la superficie celular (por ejemplo, consulte la dinámica del borde posterior en la motilidad celular en el siguiente capítulo), pero a menudo, la endocitosis es el resultado de la unión de un ligando a un receptor extracelular. molécula, lo que lleva a su activación y posterior nucleación de un ensamblaje de clatrina y formación de vesículas.

Hay muchos tipos de ligandos: una molécula de nutriente (normalmente en una proteína transportadora, como en los ejemplos siguientes) o incluso un virus atacante que ha cooptado el mecanismo endocítico para facilitar la entrada en la célula. El ejemplo que se muestra aquí es un ejemplo clásico: endocitosis del colesterol (a través de lipoproteínas de baja densidad). Esto ilustra una ruta potencial que pueden tomar los receptores y su carga. En el caso del colesterol, la proteína transportadora se descompone por completo, aunque en el caso de la transferrina, una proteína sérica que transporta hierro en la sangre, la proteína transportadora se recicla simplemente después de liberar su carga de transferrina. Se empaqueta en una vesícula exocítica que regresa a la superficie celular.

El colesterol sérico generalmente está esterificado y unido por LDL (lipoproteína de baja densidad), que luego flota en el torrente sanguíneo hasta que se encuentra con un receptor de LDL en la superficie de una célula. Cuando la LDL se une a su receptor, el receptor se activa y se forma una vesícula recubierta de clatrina alrededor del complejo LDL / receptor. Los receptores de LDL tienden a agregarse en lo que se conoce como pozos recubiertos de clatrina, vesículas parciales en forma de cráter que ya tienen una pequeña cantidad de moléculas de clatrina polimerizadas. La vesícula se forma exactamente como se describió anteriormente para las vesículas de clatrina derivadas de Golgi: la clatrina se autoensambla en una vesícula esférica y la dinamina pellizca la vesícula de la membrana celular. Esta vesícula luego se fusiona con un endosoma temprano, que transporta bombas de protones en su membrana, lo que hace que el ambiente dentro de la vesícula se acidifique (~ pH 6). Esta acidificación puede causar cambios conformacionales en las proteínas que podrían, por ejemplo, llevar a que un receptor libere su ligando, como es el caso aquí con el LDL y el receptor de LDL. El endosoma temprano también funciona como una estación de clasificación: el receptor es re-vesicularizado y transportado de regreso a la membrana plasmática. Mientras tanto, el LDL se empaqueta en una vesícula diferente y se dirige para su procesamiento posterior.

Las bombas de protones endosomales son impulsadas por ATP, Mg2+-bomba tipo V dependiente (a diferencia de la bomba tipo F en la membrana interna mitocondrial). Sin embargo, estructuralmente, los dos son similares y la hidrólisis de ATP impulsa la unidad giratoria, que luego impulsa el movimiento de protones a través de la membrana desde el citoplasma al endosoma.

A continuación, la vesícula endosómica con LDL se fusiona con otro compartimento ácido unido a la membrana. El lisosoma, a pH ~ 5.0, es incluso más ácido que el endosoma, y ​​también contiene un gran complemento de hidrolasas ácidas: enzimas hidrolíticas que varían entre sustratos (incluidas proteasas, lipasas, glicosidasas, nucleasas) que operan de manera óptima en condiciones ácidas y mínimamente en las condiciones neutrales o ligeramente básicas en el citoplasma. En parte, este es un mecanismo de seguridad: la fuga de enzimas digestivas del lisosoma no resultará en una digestión total de la célula porque las enzimas tienen poca o ninguna actividad en el citoplasma. La membrana lisosomal, además de tener bombas de protones para acidificar el ambiente interno, también incorpora muchas proteínas transportadoras para ayudar a mover los productos de la digestión de las hidrolasas ácidas fuera del lisosoma para que la célula pueda hacer uso de los aminoácidos, azúcares, nucleótidos y lípidos que resultan. Volviendo a nuestro ejemplo, eso significa que los ésteres de colesterol se descomponen en moléculas de colesterol individuales y la lipoproteína se descompone en lípidos y aminoácidos. Curiosamente, estas proteínas transportadoras no son digeridas por las proteasas lisosomales porque están muy glicosiladas, lo que protege los sitios proteolíticos potenciales de las proteasas.

Las enzimas lisosomales están marcadas específicamente por una manosa-6-fosfato que se agrega en el cis Golgi. Este es un proceso de dos pasos en el que la N-acetilglucosamina fosfotransferasa agrega una fosfo-GlcNAc a un residuo de manosa, conectándose a través del grupo fosfato, luego una fosfodiesterasa elimina la GlcNAc, dejando la manosa-6-P. Esto se dirige específicamente a las enzimas lisosomales porque todas tienen secuencias de reconocimiento de proteínas específicas a las que se une la fosfotransferasa antes de transferir la P-GlcNAc. Aunque las enzimas lisosomales están marcadas en el cis Golgi, no se clasifican hasta el trans Golgi, cuando los receptores manosa-6-P se unen a las enzimas lisosomales y forman vesículas lisosomales que brotarán y viajarán a los endosomas y lisosomas tardíos para liberar su carga útil de hidrolasa ácida. Una vez más, el cambio de pH es importante: en el entorno algo ácido (pH 6,5) del Golgi trans, el receptor se une a las enzimas marcadas con manosa-6-P, pero en el lisosoma más ácido, las hidrolasas ácidas se liberan para hacer su trabajo. trabaja.

Cuando una o más hidrolasas ácidas no funcionan correctamente o no llegan al lisosoma debido a una clasificación incorrecta, el resultado es una digestión incompleta del contenido lisosómico. Esto a su vez conduce a la formación de grandes inclusiones de material parcialmente digerido dentro de los lisosomas. Esta acumulación de material puede ser citotóxica, y los trastornos genéticos que afectan la expresión o clasificación de hidrolasas lisosomales se denominan colectivamente enfermedades de almacenamiento lisosómico. Estos se dividen en varias categorías según los tipos de moléculas acumuladas.

Una enfermedad común y fácilmente tratable de la acumulación de glicosaminoglicanos es la enfermedad de Hurler, que puede tratarse eficazmente e incluso revertir los efectos no neurológicos mediante la terapia de reemplazo enzimático. Los demás de Hurler de su clase afectan a una amplia variedad de tejidos porque los glicosaminoglicanos son omnipresentes. Por otro lado, debido a que el cerebro está enriquecido en gangliósidos, las enfermedades de almacenamiento lisosómico como la enfermedad de Gaucher muestran defectos principalmente en el SNC. Muchas enfermedades por almacenamiento lisosómico tienen una presentación similar: anomalías del desarrollo, especialmente retraso en el crecimiento de los huesos, falta de rasgos faciales finos y debilidad neuromuscular.

Dado que depende en gran medida del contenido de los endosomas que se fusionaron con él, el tamaño y el contenido de los lisosomas pueden variar mucho. De hecho, el lisosoma también puede degradar los componentes celulares internos a través del proceso de autofagia. Por lo general, esto se inicia en condiciones de inanición que conducen a la inhibición de mTor y la posterior expresión de genes autofágicos. Estos luego interactúan con las mitocondrias y otros componentes celulares y promueven la formación de un autofagosoma de doble membrana a su alrededor. El origen de las membranas no está claro, aunque se sospecha de la sala de emergencias. Finalmente, el autofagosoma se fusiona con un lisosoma y las hidrolasas ácidas descomponen las partes de la célula para obtener energía. También puede ocurrir una variación de esto llamada microautofagia, en la que el lisosoma mismo invagina un poco de material citoplasmático e internaliza una vesícula intralisosomal que luego se descompone.

La enfermedad de células I más grave (mucolipidosis tipo II) ocurre cuando casi todas las enzimas lisosomales faltan en los fibroblastos del individuo afectado. Hay un retraso del desarrollo severo y un retraso del crecimiento temprano, problemas neuromusculares y malformaciones en el desarrollo esquelético temprano. La gravedad de este trastorno se debe a la falta casi total de enzimas lisosomales, que es causada por una deficiencia de GlcNAc fosfotransferasa. Sin él, no se etiquetan enzimas para clasificarlas en el lisosoma.

Otros trastornos relativamente comunes incluyen las enfermedades de Tay-Sachs y Niemann-Pick. Tay-Sachs es causado por una acumulación de gangliósidos en el cerebro y generalmente es fatal a los 5 años de edad. Niemann-Pick, por otro lado, puede manifestarse como tipo A con una esperanza de vida aún más corta, o como tipo B, en el que los síntomas son relativamente menores. La principal diferencia es que los pacientes de tipo A tienen muy poca (<5%) de su actividad esfingomielinasa, mientras que los pacientes de tipo B tienen solo una actividad ligeramente menor de lo normal (~ 90%).

Por último, cabe señalar que las grandes vacuolas de las células vegetales son de hecho lisosomas especializados. Recuerde que las vacuolas ayudan a mantener la turgencia, o la presión del agua hacia afuera en las paredes de las células que conducen a una parte rígida de la planta en lugar de una parte flácida y marchita. Una de las formas en que esto ocurre es que las hidrolasas ácidas dentro de la vacuola alteran la presión osmótica dentro de la vacuola para regular el movimiento del agua hacia adentro o hacia afuera.

Otro ejemplo de endocitosis mediada por receptores es la importación de hierro a una célula de mamífero. Al igual que con el colesterol sérico, el hierro generalmente no se importa a la célula por sí solo. En cambio, se une a la apotransferrina, una proteína sérica que se une a dos Fe3+ iones. Una vez que se ha unido a los iones de hierro, la apotransferrina ahora se denomina transferrina y puede ser reconocida y unida por receptores de transferrina (TfR) ubicados en la superficie extracelular de las membranas celulares. Esto inicia la endocitosis mediada por receptores tal como se describió anteriormente. Sin embargo, en este caso, el lisosoma no está involucrado. A medida que la transferrina y el receptor de transferrina llegan al endosoma temprano, no se disocian, sino que el Fe2+ se libera de la transferrina y luego sale del endosoma a través de DMT1, una proteína de transporte de metal divalente que se utilizará en grupos hemo u otros complejos. Esto deja el complejo apotransferrina-TfR, que se recicla de nuevo a la membrana celular a través de una vesícula. Una vez que la vesícula se fusiona con el espacio extracelular, la acidez del endosoma se disipa y la apotransferrina ya no se une a TfR. De este modo, la apotransferrina puede volver a su deber de encontrar iones de hierro y devolverlos a la célula.


Fronteras en inmunología

Las afiliaciones del editor y los revisores son las últimas proporcionadas en sus perfiles de investigación de Loop y pueden no reflejar su situación en el momento de la revisión.


  • Descargar Articulo
    • Descargar PDF
    • ReadCube
    • EPUB
    • XML (NLM)
    • Suplementario
      Material
    • EndNote
    • Administrador de referencias
    • Archivo de texto simple
    • BibTex


    COMPARTIR EN

    Introducción

    La miosina VI (Myo6) es un miembro de la familia de la miosina de motores moleculares basados ​​en filamentos de actina que se ha implicado en una amplia gama de funciones, incluida la endocitosis mediada por clatrina, el tráfico de vesículas, la determinación de la polaridad celular y la migración celular (Buss et al. 2004). Myo6 es único entre las miosinas porque se mueve hacia el extremo puntiagudo (menos) del filamento de actina, en la dirección opuesta a la de todas las demás miosinas caracterizadas hasta ahora (Wells et al. 1999). Como los filamentos de actina en las células están orientados predominantemente con sus extremos puntiagudos hacia el interior de la célula, se ha sugerido que Myo6 puede usar la fuerza generada por su movimiento sobre los filamentos de actina para tirar o transportar cargas unidas, como vesículas endocíticas nacientes en la membrana plasmática, vesículas endocíticas apicales no recubiertas y receptores unidos a la membrana en la célula (Buss et al. 2004 Hasson 2003). En el riñón, Myo6 se expresa en gran medida en el borde en cepillo (BB) de las células epiteliales del túbulo proximal (PT), donde se localiza en parte en el dominio intermicrovillar (interMV), el sitio de la endocitosis de megalina mediada por clatrina. proteínas plasmáticas filtradas a través del glomérulo (Biemesderfer et al. 2002). Esta localización de Myo6 se establece durante la diferenciación de PT cuando las células se vuelven competentes para la endocitosis (Biemesderfer et al. 2002). Algo de Myo6 también está presente en MV (Biemesderfer et al. 2002) y en estudios de microscopía inmunoelectrónica de Yang et al. indican que hasta el 50% de Myo6 se localiza en MV en células PT de rata (Yang et al. 2005). Curiosamente, estos trabajadores observaron que existe una redistribución de Myo6 asociado a MV al dominio interMV en ratas expuestas a hipertensión arterial aguda. Por lo tanto, las diferencias en los métodos utilizados para la preparación de tejidos (p. Ej., Presión de perfusión-fijación) pueden explicar las diferencias en los niveles relativos de VM frente a la localización interMV de Myo6 que se ha informado.

    Los receptores endocíticos multiligando específicos de PT megalina y su socio de unión cubulina, una proteína de la membrana periférica, median en la reabsorción de un gran número de proteínas filtradas glomerular, incluida la albúmina, la proteína más abundante en el plasma (Birn y Christensen 2006 Christensen y Gburek 2004). Debido a que Myo6 se une directamente a las proteínas adaptadoras asociadas a clatrina Dab2 y GIPC (proteína que interactúa con G AIP, terminal C) / sinectina (Buss et al.2004), que también se unen a megalina (Lou et al.2002 Oleinikov et al.2000 ), Myo6 puede ser importante para la endocitosis de proteínas por las células PT. La importancia de la endocitosis funcional del TP se subraya por la correlación entre el grado de proteinuria y la tasa de progresión de diversas enfermedades renales y los hallazgos in vitro de que las concentraciones elevadas de proteínas inducen la producción de mediadores inflamatorios y fibrogénicos por las células tubulares (Birn y Christensen 2006). . En particular, mientras que la barrera de filtración glomerular evita el paso de la mayor parte de la albúmina sérica a la luz tubular, el glomérulo filtra una cantidad apreciable de albúmina y posteriormente la reabsorbe el PT (Birn y Christensen 2006 Gekle 2005), y la cantidad de albúmina excretada en la orina, que refleja la integridad de estos dos procesos, es un indicador importante de enfermedad renal.

    Los estudios in vitro que utilizan la expresión dominante negativa de Myo6 en líneas celulares han demostrado que Myo6 es esencial para la endocitosis mediada por clatrina y el tráfico de vesículas endocíticas no recubiertas (Aschenbrenner et al. 2003 Buss et al. 2001). Además, en neuronas deficientes en Myo6 cultivadas a partir de la función nula de Myo6 Snell & # x02019s waltzer (sv / sv) ratón, hay una inhibición selectiva de la endocitosis mediada por clatrina, ya que se inhibe la internalización del receptor de glutamato, pero no de transferrina (Osterweil et al. 2005). Estos ratones también exhiben endocitosis apical reducida y retardada de CFTR en enterocitos yeyunales (Ameen y Apodaca 2007). Sv / sv los ratones son sordos, y sus únicos fenotipos anormales evidentes son el comportamiento en círculos / hiperactivo resultante de la degeneración del epitelio neurosensorial del oído interno (Avraham et al. 1995 Deol y Green 1966) y un tamaño corporal más pequeño. En este estudio, investigamos las consecuencias fisiológicas e histológicas de la pérdida de la función de Myo6 en el riñón. Las mediciones fisiológicas y los estudios de aclaramiento renal mostraron presión arterial elevada en sv / sv ratones en comparación con animales de control mientras se mantiene la tasa de filtración glomerular (TFG), el volumen de orina y la capacidad de concentración de orina normales. Los niveles de albúmina urinaria estaban elevados en sv / sv ratones, y la captación in vivo de HRP se vio afectada en sv / sv PT, lo que indica un papel de Myo6 en la endocitosis de la proteína PT. Además, sv / sv los riñones mostraron una asociación disminuida de adaptina & # x003b2 y Dab2 con la membrana BB y un número reducido de vacuolas apicales en las células PT. Histológicamente, sv / sv los riñones presentaban dilatación y fibrosis del TP con signos de transdiferenciación epitelio-mesenquimatosa (EMT) de las células tubulares. Este estudio muestra la presencia de déficits en la reabsorción de proteínas y patología en el sv / sv riñón, con el interesante hallazgo de que la función renal general se mantiene en gran medida.


    Abstracto

    El transporte apical es clave en la función renal y la actividad de los transportadores de salida y la endocitosis mediada por receptores es fundamental en este proceso. La línea celular epitelial del túbulo proximal inmortalizada condicionalmente (ciPTEC) expresa de forma endógena estos sistemas. Aquí, usamos ciPTEC para investigar la actividad de tres transportadores de eflujo principales, a saber, la proteína de resistencia al cáncer de mama (BCRP), la proteína de resistencia a múltiples fármacos 4 (MRP4) y la glicoproteína P (P-gp), así como la absorción de proteínas a través de endocitosis mediada por receptor, utilizando una configuración basada en fluorescencia para ensayos de transporte. Con este fin, las células se expusieron a Hoechst33342, clorometilfluoresceína-diacetato (CMFDA) y calceína-AM en presencia o ausencia de inhibidores modelo para BCRP (KO143), P-gp (PSC833) o MRP (MK571). Las líneas celulares de sobreexpresión MDCKII-BCRP y MDCKII-P-gp se utilizaron como controles positivos, y se utilizaron vesículas de membrana que sobreexpresan un transportador para determinar las especificidades del sustrato e inhibidor. Se investigó la endocitosis mediada por receptores determinando la acumulación intracelular de proteína asociada al receptor marcada con fluorescencia (RAP-GST). En ciPTEC, BCRP y P-gp mostraron expresiones y actividades similares, mientras que MRP4 se expresó más abundantemente. Hoechst33342, GS-MF y calceína se retienen en presencia de KO143, MK571 y PSC833, lo que muestra una clara redundancia entre los transportadores. Es de destacar el hecho de que tanto KO143 como MK571 pueden bloquear BCRP, P-gp y MRP, mientras que PSC833 parece ser un potente inhibidor de BCRP y P-gp pero no de MRP. Además, ciPTEC acumula RAP-GST en vesículas intracelulares de una manera dependiente de la dosis y del tiempo, que se redujo en las células deficientes en megalina. En conclusión, los ensayos basados ​​en sondas fluorescentes son rápidos y reproducibles para determinar los mecanismos de transporte apical, in vitro. Demostramos que los sustratos e inhibidores típicos no son específicos para los transportadores designados, lo que refleja las complejas interacciones que pueden tener lugar en vivo. El conjunto de herramientas que describimos también es compatible con modelos innovadores de cultivo renal y permite estudiar los mecanismos de transporte que son fundamentales para la absorción, disposición y desintoxicación de fármacos.


    Abstracto

    Se sabe que la absorción de nanopartículas (NP) por una membrana celular depende del tamaño de las NP, pero la vía y la cinética de la endocitosis de múltiples NP siguen siendo ambiguas. Con la ayuda de técnicas de simulación por computadora, mostramos que la internalización de múltiples NP es de hecho un proceso cooperativo. El efecto cooperativo, que en este trabajo se interpreta como resultado de la interacción NP mediada por la curvatura de la membrana, depende del tamaño de la NP, la tensión de la membrana y la concentración de NP en las membranas. Mientras que los NP pequeños generalmente se agrupan en un agregado compacto en la membrana y se internalizan, en su conjunto, los NP de tamaño intermedio tienden a agregarse en una disposición lineal similar a una cadena de perlas, y los NP grandes tienden a separarse entre sí e internalizarse de forma independiente. . El proceso de envoltura cooperativa también se ve afectado por la diferencia de tamaño entre los NP vecinos. Dependiendo de la diferencia de tamaño de los NP vecinos y la distancia entre NP, se observan cuatro vías de internalización diferentes, a saber, internalización sincrónica, internalización asincrónica, internalización similar a pinocitosis e internalización independiente.


    DISCUSIÓN

    Nuestros datos sugieren la determinación de un dominio compartido en β-adaptinas y la subunidad reguladora H de la ATPasa vacuolar con similitud estructural y funcional significativa. Además, en las β-adaptinas, este dominio exhibe especificidad por motivos de clasificación basados ​​en di-leucina y está involucrado en el tráfico endocítico. Este hallazgo respalda los resultados previos de la proteólisis tríptica limitada de AP-1, que sugirió que el sitio de interacción del motivo LL en CD3γ reside en la porción del tronco N-terminal de ∼65-kDa de β1 (Rapoport et al., 1998).

    En este informe mostramos que el motivo de internalización basado en di-leucina de Nef se une a la estructura repetida ARM de V1H (133-483), que exhibe homología de secuencia con las β-adaptinas (Figuras 2-4). La expresión de los fragmentos homólogos de V1H, β1 y β2 en las células bloquea la internalización de las proteínas transmembrana, que dependen de motivos de clasificación basados ​​en di-leucina (Figuras 5 y 6). Ambos fragmentos de β-adaptina β1F y β2F de los complejos de proteína adaptadora AP-1 y AP-2 muestran una distribución homogénea por todo el citoplasma y la membrana plasmática de las células transfectadas (Figura 5). Esta observación sugiere que la especificidad de los complejos AP para diferentes localizaciones subcelulares resulta de subunidades que exhiben un mayor grado de heterogeneidad, a saber, las grandes subunidades α y γ (Boehm y Bonifacino, 2001), mientras que los fragmentos altamente homólogos β1F y β2F identificados aquí (92,3% de identidad de secuencia) forman un dominio estructural y funcionalmente similar. Por tanto, la expresión de los diversos dominios de unión a LL debería conducir a su asociación con motivos de leucina en prácticamente todas las ubicaciones subcelulares sin discriminar entre distintos complejos de transporte. Debido a que los dominios de unión a LL pierden la región de bisagra que contiene la señal de la caja de clatrina así como el dominio de apéndice β sucesivo, el reclutamiento de complejos de transporte competentes se inhibe al unirse a un motivo de di-leucina. Curiosamente, este efecto negativo dominante recuerda al de la construcción VHS-GAT de la proteína GGA1 utilizada por Puertolanoet al. (2001).

    Muy recientemente, se descubrió que el motivo ácido-clúster-di-leucina de las colas citosólicas de sortilina y el receptor de manosa 6-fosfato se une al dominio VHS de las proteínas GGA (Nielsen et al., 2001Puertollano et al., 2001 Zhu et al., 2001). Los GGA monoméricos son una familia de proteínas multidominio implicada en el tráfico de proteínas entre el Golgi y los endosomas. El análisis estructural previo muestra que el pequeño dominio VHS de 18 kDa de la proteína Hrs consta de tres repeticiones HEAT o ARM (Mao et al., 2000), un pliegue proteico que se ha encontrado recientemente también en la estructura de la subunidad reguladora H de la V-ATPasa (Sagermann et al., 2001). Sobre la base de la similitud de secuencia encontrada, concluimos que también las β-adaptinas y β-COP son proteínas que contienen repeticiones HEAT o ARM. Estas observaciones sugieren que las repeticiones HEAT o ARM forman el andamio estructural para el reconocimiento de motivos de clasificación basados ​​en di-leucina. Sin embargo, la especificidad detallada para los motivos de secuencia reconocidos debe determinarse individualmente para cada familia de proteínas. De acuerdo con nuestros datos, la especificidad adicional para la unión a motivos LL en β-adaptinas puede provenir de la cadena μ de los complejos de proteína adaptadora como se sugirió anteriormente (Hofmann et al., 1999). Debido a que se supone que el tronco N-terminal de las β-adaptinas se une a la cadena μ en el ensamblaje AP (Hirst y Robinson, 1998 Kirchhausen, 1999), la interfaz de estas dos moléculas podría contribuir a una superficie combinatoria para la di-leucina reconocimiento de motivos.

    Una dificultad importante en el análisis de los compartimentos de tráfico endocítico es el reconocimiento de baja afinidad de los diversos motivos in vitro (Marsh y McMahon, 1999 Pearse et al., 2000). Para el motivo LL, esta observación se empareja además con una especificidad de firma baja porque las leucinas son los residuos más abundantes, y dos residuos hidrófobos sucesivos se producen a menudo estadísticamente. La formación de un haz de múltiples hélices, como es el pliegue repetido repetitivo HEAT o ARM, es a menudo menos sensible al truncamiento N- o C-terminal que una hoja plegada en β, como es, por ejemplo, el dominio de unión YxxL en μ2. En μ2, la primera hoja β del dominio de unión de YxxL de 280 residuos se asocia con la segunda última hoja β (Owen y Evans, 1998), y los truncamientos en ambos extremos dan como resultado la pérdida inmediata del reconocimiento de la unión (Aguilar et al., 1997). Para la parte del tronco N-terminal de las β-adaptinas con su estructura helicoidal propuesta, sugerimos que un fragmento de proteína que no refleja con precisión el dominio de unión a LL requerido, pero que exhibe segmentos enlazadores flexibles, puede bloquear su propio sitio diana. Por lo tanto, la transferencia de los resultados del mapeo de V1H en función de las similitudes de secuencia con las cadenas β puede haber sido clave para determinar un fragmento en las β-adaptinas que se une a los motivos de clasificación basados ​​en di-leucina.

    A nivel especulativo, sugerimos que la señal de caja de clatrina LLNLD (Shih et al., 1995) u otros sitios LL en la región de bisagra flexible de las β-adaptinas compiten en un proceso de intercambio dinámico con motivos de clasificación de di-leucina por la unión a su sitio objetivo. Esta interacción intramolecular se vería interrumpida por el reconocimiento de una señal de clasificación LL genuina, que conduce a la exposición continua de la señal de la caja de clatrina y posteriormente induce el ensamblaje de capas de AP-clatrina. Curiosamente, en β1 y β2 adaptinas 5 LL y 3 LI sitios están presentes dentro de los 194 residuos entre el dominio de unión a LL identificado aquí y el dominio de apéndice β (Figura 7B). Esta autoinhibición podría inducir un cambio funcional mediante un cambio conformacional que indica la absorción de carga e inicia la formación de la capa de clatrina. Este modelo también explicaría por qué las jaulas de clatrina vacías nunca se observan in vivo (Kirchhausen, 1999) y se correlaciona con observaciones previas por microscopía electrónica que muestran varias disposiciones del dominio del apéndice en relación con la porción del tronco (Heuser y Keen, 1988). Curiosamente, se descubrió la autoinhibición por una señal de localización nuclear interna para Importin α y se encontró que explica el cambio regulador entre la forma citoplasmática de alta afinidad y la forma nuclear de baja afinidad para la unión de la Importin a NLS (Kobe, 1999).

    Fig. 7. Representación modelo del motivo de clasificación de di-leucina en Nef y organización de dominio propuesta de sus sitios objetivo. (A) Secuencia del bucle flexible (residuos 152-184) de VIH-1 Nef (SF2) y estructura del modelo. Ocho residuos adyacentes de ácido aspártico y glutámico forman un grupo de carga negativa fuerte en los extremos N y C del asa flexible, mientras que el motivo basado en di-leucina ExxxLL se expone mejor en su centro. El grado de conservación de la similitud basado en 186 secuencias analizadas (Geyer y Peterlin, 2001) se imprime a un lado de la secuencia. La formación del cúmulo con carga negativa se indica en la pantalla de la superficie electrostática (derecha). La figura se generó con GRASP (Nicholls et al., 1991) utilizando una pantalla de potencial electrostático de −16 kBT (rojo) a +16 kBT (azul). (B) Organización modular propuesta para el dominio de unión de di-leucina en β2 y sus dominios homólogos en V1H y β-COP. Se marcan la región de bisagra flexible que contiene la señal de la caja de clatrina y el dominio del apéndice β. Las secuencias de dominios proteicos comparten un 20,3% de identidad entre V1H y β2 y un 19,9% de identidad entre β2 y β-COP. Se indica el sitio de consenso GEY en las tres proteínas (posición 415 en V1H).

    En circunstancias normales, las moléculas de CD4 se internalizan desde la membrana plasmática a través de un motivo de leucina en su cola citoplasmática. ¿Cómo puede Nef mejorar la endocitosis de CD4 de la membrana plasmática utilizando un motivo similar basado en leucina para la internalización? La mayoría de los motivos de clasificación basados ​​en di-leucina contienen un residuo ácido corriente arriba (D / ExxxLL) o sitios de fosforilación adicionales (Wilde y Brodsky, 1996). Se encontró que un espacio mínimo desde la membrana plasmática, así como estos residuos ácidos N-terminal al motivo LL, eran críticos para la internalización (Geisler et al., 1998). Aunque la parte citosólica de CD4 no contiene estos residuos ácidos, sino que está cargada positivamente (pI 11.7), a menos que esté fosforilado en sus residuos de serina (Jarra et al., 1999), los 33 aminoácidos que abarcan el bucle flexible de Nef contienen 10 residuos ácidos (pI 4.0) ubicado principalmente en sus dos extremos (Figura 7A). Estos residuos se enfrentan entre sí y forman un grupo negativo altamente conservado corriente arriba del motivo LL (Geyer y Peterlin, 2001), que puede describirse como EEx8LLx8Señal de internalización DD. En la proteína Nef unida a la membrana, estos residuos ácidos pueden conducir a la exposición del motivo LL al citosol y satisfacer la preferencia de cargas negativas para el reconocimiento del dominio de unión a di-leucina y, por lo tanto, mejorar la internalización del complejo CD4-Nef. en comparación con CD4 solo. Por tanto, la interacción de Nef con CD4 transformaría la señal de di-leucina dependiente de la fosforilación de CD4 en una señal de di-leucina constitutivamente activa de Nef.

    Las similitudes encontradas para los fragmentos en V1H, β-adaptinas y β-COP sugieren una organización modular común de las tres proteínas diferentes (Figura 7B). Podrían contribuir a la organización de dominio compartido recientemente descrita de complejos de proteínas adaptadoras y conjuntos de coatómeros (Eugster et al., 2000 Boehm y Bonifacino, 2001). Además, nuestros resultados sugieren una función relacionada para la subunidad reguladora H de la ATPasa vacuolar. Debido a que las interacciones entre los V1 y V0 sector de la V-ATPasa son dinámicos y regulados por condiciones extracelulares (Kane, 2000), V1H podría actuar como una molécula de tráfico especializada. Los estudios futuros desentrañarán si la V-ATPasa completa es necesaria para las funciones de V1H en la clasificación intracelular y cómo se regulan estos procesos. Con la identificación de la organización del dominio en el tronco N-terminal de las β-adaptinas, ahora son posibles estudios funcionales y estructurales precisos. Los efectos negativos dominantes de los dominios de unión a LL deberían resultar útiles para estudios funcionales sobre el tráfico de proteínas que contienen motivos de clasificación basados ​​en di-leucina. Además, la estabilidad del dominio identificado parece prometedora para su posterior cristalización y caracterización estructural.


    Materiales y métodos

    1. Western blot con vivo PAG. larvas y mi. coli

    La hemolinfa (hl) de la abeja obrera de invierno y el extracto de proteína del cuerpo graso (fb) son ricos en Vg y se utilizaron para probar la unión de Vg a bacterias, adaptado del experimento Fish Vg de Tong et al. [17] utilizando un anticuerpo que detecta Vg de abeja melífera. Para obtener muestras de hl y fb sin células, consulte Havukainen et al. [33]. El experimento se realizó a temperatura ambiente, las etapas de centrifugación fueron de 3.000 g durante 5 min y el volumen de lavado fue de 0,5 ml de PBS, si no se menciona lo contrario. PAG. larvas (cepa 9820 comprada de Colecciones Coordinadas de Microorganismos de Bélgica, Gent, Bélgica) cultivada en placas de agar MYPGP durante 7 días y Epicurian Gold mi. coli cultivados en medio LB, los cultivos líquidos durante la noche se lavaron y se suspendieron en 100 µl de PBS por muestra. Las suspensiones de bacterias (

    1,3 x 108 células / ml) se mezclaron con un volumen igual de hemolinfa diluida 1/10 en PBS con un cóctel inhibidor de proteasa (Roche, Penzberg, Alemania) o con extracto de proteína de grasa corporal (5,7 mg / ml de proteína total en PBS con los inhibidores de proteasa). Se utilizaron los siguientes controles negativos: 1) 100 μl PAG.larvas y mi. coli con un volumen igual de PBS pero sin hl / fb, para detectar una posible unión inespecífica de anticuerpos a las bacterias, 2) 100 μl de fb con un volumen igual de PBS, pero sin bacterias, para detectar una posible agregación de Vg, y 3) 100 μl PAG.larvas y mi. coli tratados con 100 µl de albúmina de suero bovino 5 mg / ml (proteína de control BSA). Como controles sin tratar, se mantuvieron en hielo 0,1 μl de hl, 0,5 μl de extracto de fb y 1 μl de BSA. Las muestras se incubaron a 26 ° C durante 50 min con agitación para que se produjera la unión de bacterias Vg. Las bacterias se lavaron seis veces. El sedimento final se resuspendió en 10 µl de urea 4 M en PBS, se agitó durante 15 min y se centrifugó. Las muestras se transfirieron a una membrana de nitrocelulosa de acuerdo con un protocolo estándar de conjugado de peroxidasa de rábano picante con el anticuerpo Vg probado antes [33,34] (dilución 1: 25,000 Pacific Immunology, Ramona, CA, EE. UU.), O un anticuerpo BSA comercial ( 1: 2000 Life Technologies, Carlsbad, CA, EE. UU.). Las bandas se visualizaron usando el kit Immune-Star y el generador de imágenes ChemiDoc XRS +. Todos los reactivos de transferencia se adquirieron de Bio-Rad (Hercules, CA, EE. UU.).

    2. Microscopía de PAG. larvas y mi. coli

    La unión de Vg a bacterias se ensayó adicionalmente mediante microscopía de fluorescencia. La incubación con hl fue la anterior, excepto que los volúmenes de hl y bacterias fueron de 20 μl y el número de células bacterianas fue

    3 x 10 6. Todos los pasos de centrifugación fueron 10,000 g, + 4 ° C, 5 min y los volúmenes de lavado de PBS-T fueron de 1 ml. Después de la incubación hl con las bacterias, las bacterias se lavaron y fijaron con paraformaldehído al 4% durante 10 min a temperatura ambiente. Las células se lavaron dos veces y se bloquearon con leche al 5% en PBS-T durante 30 min a temperatura ambiente y se lavaron de nuevo. Se utilizó el anticuerpo primario Vg (igual que el anterior) 1:50 en PBS-T y leche al 1% para la incubación durante la noche a + 4ºC. Las muestras se lavaron dos veces y se incubaron con anticuerpo anti-conejo Alexa fluor 488 nm, 1:50, durante 1 h a temperatura ambiente en la oscuridad y se lavaron tres veces. El ADN se tiñó con el protocolo estándar de yoduro de propidio (PI) (Invitrogen). Las bacterias se montaron con glicerol y se obtuvieron imágenes con Zeiss Axio Imager M2, excitaciones de 499 nm y 536 nm y emisiones de 519 nm y 617 nm. El anticuerpo primario se omitió en el tratamiento de las muestras de control de anticuerpos secundarios.

    3. Resonancia de plasmón superficial con LPS, PG y zymosan

    El Vg se purificó a partir de la hemolinfa de las abejas melíferas con cromatografía de intercambio iónico como se describe anteriormente [20, 34]. Se utilizó el instrumento Biacore T200 (GE Healthcare, Waukesha, EE. UU.) Y tampones del fabricante. Los analitos se compraron a Sigma Aldrich: PG de S. aureus # 77140, LPS de mi. coli # L2630 y zymosan de S. cerevisiae # Z4250. Se inmovilizaron 30 µl / ml de Vg en tampón de acetato 10 mM, pH 4,5, en un chip CM5, cebado y acondicionado de acuerdo con las instrucciones del fabricante, hasta que la respuesta alcanzó 5150 RU. El chip se bloqueó con etanolamina. Los analitos se suspendieron en el tampón de funcionamiento (HEPES 0,1 M, NaCl 1,5 M y tensioactivo P20 al 0,5% v / v) y se calentaron a 90 ° C durante 30 min con agitación vorticial vigorosa repetida, seguido de centrifugación en una centrífuga de mesa durante 20 min. Zymosan se calentó durante 30 min más a 95 ° C antes de la centrifugación. PG y zimosán forman una suspensión fina en soluciones de agua, y formaron un sedimento durante la centrifugación, sus concentraciones se dan aquí como el peso agregado al volumen. Los analitos se analizaron con un tiempo de contacto de 120 s y un tiempo de disociación de 600 s con un caudal de 30 μl / min a 25 ° C. Los analitos que fluyen en un canal separado en un chip desnudo se utilizaron como blanco, cuyo valor se restó de la muestra. Después de optimizar el rango de unión, se midieron las siguientes concentraciones. PG: 0, 0.25, 0.5, 2, 3, 5 mg / ml LPS: 0, 0.1, 0.2, 0.9, 1.8, 3 mg / ml y zymosan: 0, 0.5, 1, 2, 3, 4 mg / ml . La unión de PG y LPS no alcanzó la saturación de unión, sin embargo, no superamos la concentración de 5 mg / ml o 3 mg / ml, respectivamente, para evitar la agregación de analitos (consulte la información del fabricante y las referencias allí para las concentraciones de trabajo).

    4. Microscopía de los ovarios reinos

    Seis de un año A. mellifera ligustica las reinas se anestesiaron en hielo. Sus ovarios se disecaron y lavaron en PBS helado. A continuación, se colocó uno de los ovarios emparejados por reina en una solución de control (50 μl de PBS que contenían 2 mg / ml de Texas Red etiquetado mi. coli Bioparticles Life Technologies, Carlsbad, CA, EE. UU.) Y el otro ovario se colocó en la misma solución que contenía, además, 0,5 mg / ml de Vg purificado de hemolinfa de abeja melífera [20,33]. Los ovarios se incubaron a 28ºC durante 2 h en agitación. A continuación, los ovarios se lavaron dos veces en 1 ml de PBS helado durante 5 min con agitación. Se montaron directamente muestras de dos reinas usando Fluoromount (Sigma) y se observaron mediante microscopía de campo brillante y fluorescencia (excitación 595 nm, emisión 615 nm) (Axio Imager M2, Carl Zeiss AG, Oberkochen, Alemania). Se obtuvieron imágenes de una reina testigo adicional sin tratar para la detección del área pedical autofluorescente del ovario. Las cuatro reinas restantes se incrustaron en Tissue-Tek (Sakura Finetek, Torrance, CA, EE. UU.) Y se almacenaron a -80ºC. Estos ovarios se cortaron en secciones de 17 mm a -20ºC y se tomaron imágenes inmediatamente después del montaje. Los ajustes de microscopía se mantuvieron constantes durante la formación de imágenes.

    Para probar si las proteínas de hemolinfa podrían desencadenar la captación de elicitores inmunes incluso en ausencia de Vg, modificamos la configuración experimental para incluir proteínas de hemolinfa distintas de Vg, la mayoría de las cuales son apolipoforina y hexamerinas, ambas conocidas por unirse a los elicitores inmunes [35 ]. Las otras proteínas de hemolinfa se obtuvieron mediante cromatografía de intercambio iónico en hemolinfa de abejas y dividiendo las fracciones de hemolinfa recolectadas en proteínas Vg y no Vg (Fig. S1) [20,33]. Las moléculas restantes de hemolinfa de pequeño peso molecular, como posibles péptidos y hormonas, se eliminaron durante la concentración de proteínas utilizando filtros centrífugos con un límite de 50 kDa con fracciones Vg y no Vg (Millipore, Billerica, MA, EE. UU.). Se descartaron las fracciones que contenían tanto Vg como otras proteínas de hemolinfa.Las proteínas Vg y no Vg tenían una concentración final de 0,5 mg / ml en el experimento. Las reinas estaban como arriba. La configuración fue la siguiente (todas las incubaciones contenían el mi. coli Biopartículas 1,5 mg / ml): un ovario se incubó con Vg y el otro ovario con solución de control (ver arriba) (N = 3) uno con Vg y el otro con proteínas de hemolinfa no Vg (N = 3), y un ovario con proteínas de hemolinfa no Vg y el otro con solución de control (N = 2). La formación de imágenes de la crio-sección se realizó como anteriormente.


    Resultados

    Generación de ratones deficientes en EHD1

    Se generaron ratones deficientes en EHD1 usando una estrategia de recombinación como se describe en Métodos (Figura 1A). El análisis de PCR del ADN de la cola confirmó la Ehd1 el gen se apuntó correctamente en heterocigotos suprimidos (Ehd1 +/-), homocigoto eliminado (Ehd1 - / -), heterocigoto floxado (Ehd1 fl-Neo/ +) y homocigotos floxados (Ehd1 fl-Neo / fl-Neo ) ratones (Figura 1B). RT-PCR también confirmó la ausencia de Ehd1 ARNm en los testículos de Ehd1 - / - ratones macho (Figura 1C).

    Generación de Ehd1 -/- ratones usando Cre / loxP recombineración genética mediada. (A) Un mapa de restricción parcial del Ehd1 locus, el vector de direccionamiento y el mutado Ehd1 loci. El primer exón fue eliminado por Cre /loxPrecombinación mediada. Los rectángulos negros representan exones, los triángulos grises y blancos representan loxP y FRT secuencias, respectivamente. H PosteriorIII RI, EcoRHODE ISLAND. (B) Se preparó ADN a partir de colas de ratón para genotipificación mediante PCR para amplificar el WT Ehd1 alelo, el alelo eliminado y / o el alelo flojo. El carril etiquetado como "sin plantilla" indica un control negativo en ausencia de ADN. (C) El análisis de RT-PCR se llevó a cabo utilizando ADNc generado a partir de testículos de ratón y cebadores específicos para Ehd1 y Ehd4. Los cebadores se describen en Métodos.

    Anteriormente, mostramos que las proteínas EHD se expresaban en varios órganos de ratón tanto en ratones machos como hembras [7]. Western blots realizados en lisados ​​de órganos de ratón obtenidos de WT, Ehd1 +/- y Ehd1 - / - ratones confirmaron que la interrupción de Ehd1 condujo a una pérdida de la expresión de la proteína EHD1 en Ehd1 - / - ratones machos (Figura 2) y hembras (datos no mostrados). Se observaron niveles intermedios de EHD1 en el pulmón, riñón, corazón, bazo y testículos de Ehd1 +/- ratones en comparación con WT y Ehd1 - / - ratones (Figura 2). Estos resultados demostraron que la estrategia de focalización condujo a la pérdida completa de la expresión de EHD1 en Ehd1 - / - tejidos de ratón.

    Expresión de la proteína EHD en adultos WT, Ehd1 +/- y Ehd1 -/- ratones machos. Se separaron alícuotas de 100 µg de lisados ​​de tejido derivados de ratones macho de siete meses usando SDS-PAGE al 7,5% y se realizaron transferencias Western usando antisueros producidos contra proteínas EHD como se describe en Métodos. El * indica bandas que sangraron a través de la mancha previa después de la extracción. La movilidad diferencial de Hsc70 puede representar isoformas específicas de tejido. Los marcadores de peso molecular relativo (MW) se indican en kiloDaltons (kD). Hsc70 sirvió como control de carga.

    Supresión de Ehd1en diferentes cepas de ratón da como resultado una letalidad parcial

    Cruces de Ehd1 +/- ratones en un fondo mixto 129B6 no produjeron la proporción mendeliana esperada de Ehd1 - / - ratones (8% en lugar del 25% esperado fueron Ehd1 - / - en los días postnatales 10-12) (Tabla 1). Estos resultados indicaron que la pérdida de EHD1 fue parcialmente letal. Se observaron resultados similares después de siete retrocruces (N7) con la cepa FVB / NJ (11% en lugar del 25% esperado fueron Ehd1 - / - n = 106 ratones). La cepa mixta 129B6 se usó en análisis adicionales a menos que se especifique.

    La progenie de cruces de Ehd1 +/- ratones eran 49% hembras y 51% machos con el doble de Ehd1 +/- en comparación con los ratones WT, lo que indica proporciones de género normales y una falta de letalidad cuando una copia de Ehd1 era presente. Se realizó un estudio separado en el que se examinó el genotipo de las crías que murieron por causas desconocidas entre los días 0 y 2 posnatales. Curiosamente, 24 de 48 cachorros (50%) fueron Ehd1 - / - ratones, lo que indica una frecuencia desproporcionadamente más alta (esperada

    25%) de muerte entre Ehd1 - / - ratones al nacer o cerca del nacimiento.

    Ehd1 - / - los ratones son más pequeños que los ratones WT y muestran defectos de desarrollo

    Ehd1 - / - los ratones que sobrevivieron a la letalidad neonatal temprana eran más pequeños que WT y Ehd1 +/- compañeros de camada desde el nacimiento (Figura 3A) hasta la edad adulta (Figura 3B). Tanto los ratones machos como las hembras mostraron pesos más bajos en comparación con los controles (Figura 3C-D). En varios casos, Ehd1 - / - las hembras mostraron maloclusión (4/18, 22%) que requirió un recorte de los incisivos quincenalmente hasta la edad adulta para evitar la muerte. Algunos animales fueron sacrificados debido a un tamaño anormalmente pequeño y desnutrición a la edad de 3-4 semanas, independientemente de los problemas de los incisivos, y varios otros murieron en esta época debido a causas desconocidas. Una proporción sustancial de los supervivientes Ehd1 - / - los animales presentaban defectos oculares graves (

    55% de ojos n = 39 animales) incluyendo anoftalmia (rara), microftalmia (casos severos exhibieron párpados cerrados) y cataratas centrales congénitas. La naturaleza de los defectos del desarrollo ocular en Ehd1 - / - los ratones se persiguen por separado.

    Ehd1 -/- Los ratones son más pequeños que los controles de los compañeros de camada y los adultos. Ehd1 -/- los machos exhiben pequeños testículos. (A) Se fotografiaron cachorros recién nacidos y (B) ratones machos de siete meses para mostrar el tamaño del Ehd1 - / - ratones en comparación con los controles de los compañeros de camada. (C) Curvas de crecimiento cuantitativo de ratones control machos y (D) hembras de camada (se muestra el valor n para cada uno). (E) Se disecaron las vesículas seminales y los testículos de los ratones representados en (B). Las barras de error representan la desviación estándar de la media. ** indica estadísticamente significativo usando una prueba t de dos muestras con un análisis de dos colas (p & lt 0.05).

    Ehd1 - / - los ratones machos son infértiles

    A pesar de nuestros repetidos intentos de aparearnos Ehd1 - / - ratones, no se generó progenie, lo que indica la falta de fertilidad de uno o ambos sexos. Cría Ehd1 +/- machos con Ehd1 - / - las hembras dieron lugar a crías sanas (Tabla 1) solo el 29% (en lugar del 50% esperado) de los ratones que sobrevivieron hasta la edad del destete fueron Ehd1 - / -. Por razones desconocidas, el porcentaje de Ehd1 - / - los ratones que sobrevivieron hasta la edad del destete en comparación con las predicciones mendelianas fueron más altos cuando fueron criados por un Ehd1 - / - presa versus una Ehd1 +/- presa. Estos resultados documentaron además que Ehd1 - / - las hembras eran fértiles y la letalidad parcial en Ehd1-Ratones nulos (actualmente en investigación).

    Para probar si Ehd1 - / - los machos eran fértiles, los machos de 8 semanas se alojaron con dos hembras adultas vírgenes cada uno. A pesar del comportamiento normal de apareamiento, determinado por su capacidad para montar hembras y dar lugar a un enchufe copulador, no Ehd1 - / - los ratones machos eran capaces de engendrar descendencia, lo que indica que Ehd1 - / - los machos eran infértiles (Tabla 1). Las hembras utilizadas en estos experimentos demostraron ser competentes para ser preñadas por otros machos fértiles después de la reproducción inicial con Ehd1 - / - machos. La habilidad de ocho Ehd1 fl-Neo / fl-Neo parejas reproductoras para producir progenie con éxito proporcionó evidencia de que la presencia de loxP sitios en el objetivo Ehd1 El gen no causó defectos en la fertilidad o la supervivencia general al influir en un gen no dirigido.

    Anteriormente, se demostró que una deleción C-terminal de EHD1 en ratones no tenía efectos en la viabilidad, el crecimiento o la fertilidad en las cepas 129 / SvEv o Swiss Webster [27]. Para determinar si los defectos de fertilidad en el Ehd1 - / - los ratones machos fueron influenciados por antecedentes genéticos, cruzamos Ehd1 +/- ratones dos veces en la cepa FVB / NJ (N2) y luego generaron Ehd1 -/- ratones. La resultante Ehd1 - / - los ratones machos eran infértiles mientras Ehd1 - / - las hembras eran fértiles (n = 8). El retrocruzamiento posterior reveló que Ehd1 - / - Los ratones machos de la cepa FVB / NJ (N7) también eran infértiles (n = 4), lo que indica que la pérdida de EHD1 conduce a una infertilidad completa en los ratones machos independientemente de la cepa.

    Adulto Ehd1 - / - los ratones machos exhiben testículos pequeños

    El peso bruto de los testículos, el bazo y los riñones de Ehd1 - / - los ratones macho en el día 10 y 30 postnatal no fueron estadísticamente diferentes de los ratones WT (Tabla 2). Sin embargo, a partir del día 42, los testículos en Ehd1 Los ratones - / - eran más pequeños que los de los ratones WT, lo que indica el primer retraso en el desarrollo de los testículos según lo determinado por el peso (Tabla 2, Figura 3E). Curiosamente, las vesículas seminales dependientes de andrógenos eran comparables en tamaño entre WT, Ehd1 +/- y Ehd1 - / - ratones (Tabla 2, Figura 3E), lo que sugiere que los niveles hormonales no se vieron afectados. Los niveles séricos de testosterona de los ratones fueron variables, sin embargo, los niveles en Ehd1 - / - los ratones estaban dentro de un rango comparable a los de WT y Ehd1 +/- ratones adultos (824,5 ± 1364,0 ng / dL para WT [n = 3], 646,1 ± 859,4 ng / dL para Ehd1 +/- [n = 2] y 445,8 ± 511,4 para Ehd1 - / - [n = 11], edades de 9 a 69 semanas, p & gt 0,05). El fenotipo de testículo pequeño fue similar en ratones N2 y N7 FVB / NJ (datos no mostrados).

    Expresión de EHD1 en el desarrollo de testículos de ratón posnatal

    Para evaluar la Ehd1 expresión de ARNm, en el lugar Las hibridaciones se llevaron a cabo en el desarrollo de testículos de ratón. Ehd1 El ARNm se expresó en la mayoría de las células del epitelio seminífero (Figura 4), incluidas las células de Sertoli (Figura 4, recuadro E ').

    Expresión de ARNm de ehd1 en el desarrollo de testículos de ratón posnatal. En el lugar Las hibridaciones se realizaron como se describe en Métodos en WT (+ / +) y Ehd1 - / - (- / -) secciones de testículo preparadas a partir de ratones 10, 30, 36, 42 (P10-P42) y 10 meses (10 m) postnatales. Ehd1 La expresión de ARNm se puede ver en rojo en imágenes de campo oscuro superpuestas sobre imágenes de campo claro. Los paneles A'-I 'son aumentos más altos de los paneles A-I, respectivamente. El recuadro dentro de E 'es una micrografía ampliada del recuadro en las flechas E' que denotan núcleos de células de Sertoli. La barra de escala en el panel I es de 100 μm para B-J, 50 μm para A, C'-I 'y 25 μm para A'.

    Para evaluar la expresión de la proteína EHD en las primeras etapas del desarrollo de los testículos, se realizó una transferencia de Western (Figura 5A, panel superior). EHD1, EHD2 y EHD4 se expresaron en WT testis en los días 10-42, mientras que los niveles de EHD3 fueron relativamente bajos. Curiosamente, Ehd1 - / - los testículos mostraron un aumento en la expresión de EHD2, EHD3 y EHD4 en los días 30, 36 y 42. EHD1, EHD2 y EHD4 también se expresaron en una línea celular de Sertoli de ratón inmortalizada (TM4) analizada por Western blot (Figura 5A, inferior panel).

    Expresión de la proteína EHD y localización de EHD1 durante el desarrollo de los testículos del ratón. (A, panel superior) Se separaron alícuotas de 50 μg de lisados ​​de testículo de ratones 10-42 del día postnatal utilizando SDS-PAGE al 8% y se realizó una transferencia Western utilizando anticuerpos purificados por afinidad producidos contra EHD1 (descritos en Métodos), seguido de reprobación en serie con antisueros contra proteínas EHD como se describió anteriormente [7]. La β-actina sirvió como control de carga. El * denota bandas que sangraron a través de la mancha anterior. (A, panel inferior) Alícuotas de 20 μg de células de Sertoli TM4 de ratón inmortalizadas y fibroblasto embrionario de ratón (MEF, Ehd1 fl-Neo / fl-Neo ) los lisados ​​se trataron de manera similar, excepto que la membrana se probó con antisueros que reconocen EHD1 y EHD4 seguidos de EHD2. (B, C) Se llevó a cabo inmunohistoquímica para determinar la localización de EHD1 en los días 10 y 30 secciones de testículos fijados con formalina de WT y Ehd1 -/- ratones. La expresión de EHD1 se puede ver cuando los núcleos de tinción marrón se tiñen con hematoxilina (azul). Los paneles A y B contenían anticuerpos primarios anti-EHD1 purificados por afinidad, mientras que los paneles C y D carecían de anticuerpos primarios (control). Los recuadros del panel A son micrografías ampliadas de las celdas resaltadas. Nota: se pueden ver túbulos seminíferos similares de secciones adyacentes en A y C, así como en B y D indicados con asteriscos (**). Sc - Célula de Sertoli, Sg - espermatogonias. Barra de escala = 100 μm.

    Para determinar la localización de EHD1 dentro del testículo, se realizó una inmunohistoquímica que reveló la expresión de EHD1 en la mayoría de las células del epitelio seminífero. En el día 10 postnatal, EHD1 se expresó en el citoplasma de espermatogonias (puntas de flecha llenas) y células de Sertoli (puntas de flecha abiertas) en la membrana basal con señales más altas cerca de las superficies lateral y apical de estas células (Figura 5B, panel A). La expresión de EHD1 también se observó alrededor del núcleo de las espermatogonias (flecha) hacia el lumen de los túbulos seminíferos (Figura 5B, panel A). Como era de esperar, la expresión de EHD1 estuvo ausente en Ehd1 - / - testículo (Figura 5B-C, panel B). El día 30, EHD1 se localizó en el citoplasma de las células de Sertoli y espermatogonias cerca de la base de los túbulos seminíferos. Además, EHD1 se expresó en espermatocitos de paquiteno y espermátidas redondas y alargadas (Figura 5C, panel A). Se observaron patrones similares en testículos WT adultos (no mostrado).

    Ehd1 - / - los ratones muestran una variedad de anomalías en la espermatogénesis

    Durante la espermatogénesis, las espermatogonias experimentan divisiones mitóticas y se diferencian en espermatocitos. Los espermatocitos experimentan dos divisiones meióticas, se diferencian en espermátidas redondas que luego forman espermátidas alargadas y se liberan de las células de Sertoli durante la espermiación. La progresión de la espermatogénesis se describe utilizando histología de secciones transversales de túbulos seminíferos en etapas (I-XII) que definen el desarrollo morfológico de las células germinales como grupo [28, 29]. La morfología de una espermátide individual en la espermiogénesis se describe como un paso que es seguido más fácilmente por la formación y forma del acrosoma teñido con ácido periódico-Schiff (PAS), o menos fácilmente mediante la evaluación de la condensación de cromatina y la forma de la cabeza de la espermátide [28]. Con el fin de discernir las lesiones iniciales en la espermatogénesis, llevamos a cabo análisis histológicos de testículos en ratones de 10, 30 y 42 días de edad. En cada edad, el ancho promedio de los túbulos seminíferos fue comparable entre WT y Ehd1 - / - ratones que indican que la formación de lumen por el epitelio seminífero no se vio afectada en ausencia de EHD1 (Tabla 2).

    En el día 10 postnatal, los túbulos seminíferos WT contenían predominantemente células de Sertoli y algunos espermatocitos de paquiteno, el tipo de células germinales más avanzado visto a esta edad (Figura 6A). Las espermatogonias estaban presentes cerca de la membrana basal y se observaron pocas características apoptóticas (Figura 6B) [30]. Ehd1 - / - los túbulos seminíferos eran similares en apariencia, y también mostraban algunas características apoptóticas en la luz y cerca de la membrana basal (Figura 6C-D). Parecía haber un retraso en la maduración normal de las espermatogonias y los espermatocitos de paquiteno en Ehd1 - / - en comparación con los ratones WT analizados por condensación de cromatina y tamaño celular. Además, algunos Ehd1 - / - los túbulos seminíferos contenían un mayor número de cuerpos densos de tipo apoptótico que el WT. Sin embargo, no se detectaron lesiones importantes en los túbulos seminíferos de Ehd1 - / - ratones en el día 10.

    El día posnatal 10 secciones transversales de túbulos de Ehd1 -/- Los testículos de ratones machos no muestran lesiones importantes.. Los testículos del día 10 se fijaron con Bouin, se tiñeron con PAS y se tiñeron con hematoxilina para visualizar las glicoproteínas / acrosomas (rosa) y los núcleos (azul) y se analizaron mediante microscopía óptica usando una lente de objetivo de 40x. Las etapas están etiquetadas con números romanos. (A, B) Los túbulos seminíferos de los ratones WT (+ / +) exhiben núcleos de células de Sertoli (Sc) cerca de la membrana basal o hacia el lumen, espermatogonias grandes (Sg) cerca de la membrana basal, espermatocitos de paquiteno (P) y ocasionalmente apoptóticos núcleos similares a (Ap) cerca de la luz. (C, D) Los túbulos seminíferos de Ehd1 Los ratones - / - (- / -) se muestran a modo de comparación. Barra de escala en A = 50 μm para A-D.

    El día 30, la espermatogénesis normal fue aparente en ratones WT con células germinales bien organizadas típicas de la primera ola de espermatogénesis. En general, las células de Sertoli estaban cerca de la membrana basal mientras que las espermátidas alargadas revestían el lumen (Figura 7A, estadio I-II) y se observó meiosis normal en los espermatocitos (Figura 7A, estadio XII). Las espermátidas redondas mostraron una apariencia redonda / ovoide hasta la etapa IX, cuando la cabeza de la espermátide formó una superficie dorsal y ventral con el acrosoma principalmente en la superficie dorsal de las espermátidas del paso 9 (Figura 7B). A diferencia de, Ehd1 - / - los túbulos seminíferos mostraban células anormales en la meiosis (Figura 7C, estadio XII) y espermátidas alargadas que mostraban una orientación, forma y condensación de cromatina anormales (Figura 7C, estadio X). Algunos Ehd1 - / - los túbulos seminíferos mostraron un fenotipo de células de Sertoli que no se ven en el WT (Figura 7D), lo que indica una falta completa de células germinales. Curiosamente, se observó un retraso en la maduración de las espermátidas alargadas con una mezcla de espermátidas (paso 9, 10 y 11) presente en una sección transversal del túbulo seminífero (Figura 7E). En ratones WT, el casquete acrosómico PAS positivo de espermátidas redondas cubría más de un tercio del núcleo en la etapa VII con un gránulo acrosómico central (Figura 7F). Sin embargo, en Ehd1 - / - ratones, los casquetes acrosomales parecían anormales con formaciones asimétricas (Figura 7G) y apariencias puntiformes (Figura 7H). Ni el Ehd1 - / - ni los epidídimos WT contenían espermatozoides en el día 30, lo que confirma que estos animales estaban en las ondas iniciales de espermatogénesis. Dado que las espermátidas redondas se forman antes del día 30 (días 20-25), puede haber lesiones que no se aclararon en el estudio actual.

    Desarrollo anormal de acrosomas y espermátides en adolescentes Ehd1 -/- ratones machos. Los testículos del día 30 se fijaron con Bouin, se tiñeron con PAS y se tiñeron con hematoxilina para visualizar las glicoproteínas / acrosomas (rosa) y los núcleos (azul) y se analizaron por microscopía óptica utilizando una lente de objetivo (AE) de 40 × o una lente de objetivo de 60 × bajo inmersión en aceite (FH). Las etapas están etiquetadas con números romanos. (A) Túbulos seminíferos en estadio XII WT (+ / +) con espermátidas alargadas y espermatocitos en el paso 12 en la meiosis I y II. (B) Túbulos seminíferos WT en estadio IX con espermátidas del paso 9. (C) Ehd1 - / - (- / -) Los túbulos seminíferos en estadio XII muestran figuras meióticas anormales (Me). El estadio X muestra una mezcla de pasos espermátidos con orientación, forma y condensación de cromatina anormales (flechas). (D) Una Ehd1 - / - túbulo seminífero que exhibe un fenotipo de células de Sertoli solamente (SCO) y un túbulo seminífero en estadio (E) IX-XI que contiene espermátidas alargadas de los pasos 9, 10 y 11 (flechas). (F) Espermátidas redondas de estadio VII WT con tapas acrosomales PAS positivas en el desarrollo de espermátidas redondas del paso 7 (flechas). (G-H) Ehd1 - / - las espermátidas redondas del paso 7 muestran tapas acrosomales anormales (flechas), mientras que otras muestran un desplazamiento anormal del gránulo acrosómico, formaciones asimétricas y apariencias puntuales. Barra de escala en A = 50 μm para A-E. Barra de escala en F = 10 μm para F-H.

    En el día 42, los epidídimos en ratones WT contenían espermatozoides maduros mientras que Ehd1 - / - los ratones carecían de esperma (Figura 8) este defecto continuó hasta la edad adulta. Para obtener más información sobre la espermatogénesis anormal, llevamos a cabo un examen detallado de WT de 42 días y Ehd1 - / - testículos de ratón.Los ratones WT mostraron espermatogénesis normal donde un solo paso de espermátidas redondas y alargadas fueron soportadas por células de Sertoli de una manera ordenada y uniformemente espaciada en secciones transversales de túbulos seminíferos (Figura 9A-C). Por otro lado, la espermatogénesis solo parecía normal antes de la formación del acrosoma en Ehd1 -/- ratones. Varios Ehd1 - / - las secciones transversales de los túbulos seminíferos exhibieron una mezcla de espermátidas alargadas (Figura 9D, pasos 9-11), así como espermátidas alargadas desalineadas cerca de la membrana basal, lo que sugiere la fagocitosis de células de Sertoli de las espermátidas del paso 16 que no pudieron ser liberadas (Figura 9D -E, círculos). En la etapa VIII tardía, se observó falla de la espermiación y aglutinación de las cabezas de las espermátidas, además de la fusión de grandes agregados de cuerpos residuales y lóbulos citoplasmáticos que contenían espermátidas agrupadas (Figura 9F-H, flechas). En la etapa X, se observó aglutinación de espermátidas del paso 16 en ruedas membranosas y cerca de la membrana basal (Figura 9I). Las espermátidas del paso 16 también se observaron con sus cabezas y colas fusionadas, su citoplasma no pudo formar lóbulos citoplasmáticos y cuerpos residuales que normalmente son reabsorbidos por las células de Sertoli (Figura 9J). Ehd1 - / - testículo también mostró espermátidas anormales del paso 11 (Figura 9J). Por lo tanto, nuestros resultados demuestran claros defectos de espermatogénesis y espermiación en Ehd1-Testículos nulos.

    Ehd1 -/- los ratones machos carecen de espermatozoides epididimarios maduros en el día 42. Los epidídimos de capullo del día 42 se fijaron con Bouin, se tiñeron con PAS y se tiñeron con hematoxilina para visualizar las glicoproteínas (rosa) y los núcleos (azul) y se analizaron mediante microscopía óptica usando una lente de objetivo de 40x. (A) Los epidídimos WT (+ / +) contenían una capa epitelial columnar (E) con una capa lisa de actina (flecha) debajo de las microvellosidades largas PAS positivas que se extienden hacia la luz. Había espermatozoides maduros (S) en la luz. (B) El Ehd1 - / - (- / -) epidídimos contenían algunas espermátidas redondas desprendidas (Spt) y espermatocitos (Spc). Barra de escala = 20 μm.

    Día 42 Ehd1 -/- Los testículos muestran un retraso en el desarrollo de las espermátidas y aglutinación anormal de espermátidas.. Los testículos del día 42 se fijaron con Bouin, se tiñeron con PAS y se tiñeron con hematoxilina para visualizar las glicoproteínas / acrosomas (rosa) y los núcleos (azul) y se analizaron mediante microscopía óptica usando una lente de objetivo de 40x. Las etapas están etiquetadas con números romanos. Los túbulos seminíferos (AC) WT (+ / +) mostraban espermátidas redondas y alargadas uniformemente espaciadas. (D) Ehd1 - / - (- / -) túbulos seminíferos contenían espermátidas alargadas de paso 9, 10 y 11 (flechas) y espermátidas alargadas de paso 16 desorientadas cerca de la membrana basal (círculos) y (E) espermátidas de paso 9 anormales junto con agregados del paso 16 espermátidas (círculos). (F-H) Ehd1 - / - los túbulos seminíferos mostraban ruedas membranosas o cuerpos residuales (flechas, Rb) que contenían espermátidas agrupadas cerca de la luz en la etapa VIII, (I) espermátidas desalineadas (círculo) y núcleos de espermátidas agrupados del paso 16 (flechas) en la etapa X, (J) espermátidas anormales del paso 11 en el estadio XI y espermátidas del paso 16 que se agrupan en ruedas membranosas en el estadio VIII. Barra de escala = 50 μm.

    Para caracterizar aún más los defectos en la espermatogénesis en Ehd1 - / - ratones a nivel ultraestructural, se llevaron a cabo análisis de microscopía electrónica de transmisión en secciones delgadas de los testículos. En el estadio VIII de WT testis (Figura 10A), se encontraron espermátidas alargadas cerca del lumen o en el lumen después de la espermiación (Figura 10B). Las espermátidas alargadas que no se habían espermiado mantuvieron una especialización ectoplásmica apical en contacto con las células de WT Sertoli (Figura 10C). Sin embargo, a finales de la etapa VIII de Ehd1 - / - testículo (Figura 10D), aparecieron espermátidas alargadas en ruedas membranosas fagocíticas (Figura 10E, recuadro). Tras un examen más detenido, la rueda fagocítica estaba revestida por especializaciones ectoplásmicas y contenía los núcleos, acrosomas y colas de espermátidas alargadas (Figura 10F). Dado que la función adecuada de las células de Sertoli requiere un tráfico endocítico constante [31], suponemos que el tráfico y el reciclaje endocítico dependiente de EHD1 pueden ser necesarios para la espermiación en ratones.

    Las micrografías electrónicas de los túbulos seminíferos del día 45 revelan ruedas membranosas fagocíticas anormales en Ehd1 -/- ratones. (A) En ratones WT, se encontraron espermátidas redondas de paso 8 en (B) túbulos seminíferos de etapa VIII temprana que contenían espermátidas alargadas en el proceso de espermiación cerca del lumen con colas aparentes después de la caja de espermia agrandada en (C). (C) Una espermátide alargada WT antes de la espermiación mantiene sus especializaciones ectoplásmicas (ES). (D) En Ehd1 - / - ratones, espermátidas redondas de paso 8 se encontraron en (E) túbulos seminíferos de etapa VIII tardía que contenían ruedas membranosas fagocíticas que envolvían espermátidas alargadas, sus acrosomas y caja de colas de esperma agrandados en (F).


    • Abstracto
    • 1.1 Membranas de células procariotas
    • 1.2 Membranas de células eucariotas
    • 1.3 Membranas de plasma
    • 1.4 Membranas intracelulares
    • 1.5 membranas virales
    • 1.6 Motivos de membrana
    • 1.7 El efecto hidrofóbico
    • 1.8 Estructura del agua
    • 1.9 Moléculas no polares y agua
    • 1.10 Aspectos destacados
    • Referencias

    Capítulo 2. Los lípidos de las membranas biológicas

    • Abstracto
    • 2.1 Fosfolípidos
    • 2.2 Esfingolípidos
    • 2.3 Glicolípidos
    • 2.4 Esteroles
    • 2.5 Lípidos de dos cabezas
    • 2.6 Lipopolisacárido
    • 2.7 Identificación de lípidos
    • 2.8 Aspectos destacados
    • Referencias

    Capítulo 3. Biogénesis de los lípidos de membrana

    • Abstracto
    • 3.1 Desaturación de ácidos grasos
    • 3.2 Biosíntesis de fosfolípidos
    • 3.3 Biosíntesis de esfingolípidos
    • 3.4 Biosíntesis de colesterol
    • 3.5 Ensamblaje de lípidos recién sintetizados en membranas
    • 3.6 Aspectos destacados
    • Referencias
    • Abstracto
    • 4.1 Detergentes no iónicos
    • 4.2 Detergentes iónicos
    • 4.3 Propiedades del detergente
    • 4.4 Detergentes y balsas de membranas
    • Referencias

    Capítulo 5. Modelos de membrana

    • Abstracto
    • 5.1 La evidencia de la bicapa lipídica
    • 5.2 El modelo de Singer Nicholson para membranas
    • 5.3 Modelo actual de membranas biológicas
    • 5.4 Aspectos destacados
    • Referencias

    Capítulo 6. Sistemas de membrana de laboratorio

    • Abstracto
    • 6.1 Estructura de los sistemas de membranas de laboratorio
    • 6.2 Propiedades derivadas de los sistemas de membranas de laboratorio
    • 6.3 Hidratación
    • 6.4 Unión de iones
    • 6.5 Aspectos destacados
    • Referencias

    Capítulo 7. Estructuras de los conjuntos lipídicos

    • Abstracto
    • 7.1 Estructura laminar (bicapa)
    • 7.2 Bicapas interdigitadas
    • 7.3 Fase micelar
    • 7.4 Fase I hexagonal (HI)
    • 7.5 Fase hexagonal II (HII)
    • 7.6 Fase cúbica
    • 7.7 Subfase para bicapas de fosfolípidos
    • 7.8 Fase de solución
    • 7.9 Transiciones de fase lipídica
    • 7.10 Transiciones de fase en membranas celulares
    • 7.11 Transición de fase lamelar a HII
    • 7.12 Microdominios lipídicos en membranas
    • 7.13 Conformación de lípidos en membranas
    • 7.14 Agua en la bicapa lipídica
    • 7.15 Aspectos destacados
    • Referencias

    Capítulo 8. Dinámica de lípidos en membranas.

    • Abstracto
    • 8.1 Introducción
    • 8.2 ESR
    • 8,3 2H RMN
    • 8.4 Orden de movimiento
    • 8.5 Tasas mocionales
    • 8.6 Vista integrada del orden y la dinámica de los movimientos
    • 8.7 Fluidez de la membrana
    • 8.8 Volumen libre dentro de una bicapa de membrana
    • 8.9 Difusión lateral de componentes de la membrana
    • 8.10 Separación de fase lateral
    • 8.11 Movimiento transmembrana de lípidos
    • 8.12 Movimiento de fosfolípidos entre membranas
    • 8.13 Asimetría de lípidos transmembrana
    • 8.14 Aspectos destacados
    • Referencias

    Capítulo 9. Colesterol y esteroles relacionados: funciones en la estructura y función de la membrana


    4. DISCUSIÓN

    Demostramos que los miARN regulaban la expresión de AQP5 en la línea celular de cáncer de mama triple negativo altamente agresiva e invasiva (células MDA-MB-231). Los miARN dirigidos a AQP5 se identificaron usando análisis bioinformáticos basados ​​en las secuencias de AQP5 3ʹ-UTR y miARN (Tabla 1). Cuando las células MDA-MB-231 se sobreexpresaron con el miARN identificado que apunta a AQP5 (miR-1226-3p, miR-19a-3p o miR-19b-3p), la expresión de la proteína AQP5 disminuyó significativamente, asociada con la inhibición de la célula. migración en respuesta a las condiciones quimiotácticas y estimuladas por LDL. Para administrar miARN dirigido a AQP5 a las células cancerosas de manera eficiente, se estableció la administración de miARN mediada por exosomas. El péptido dirigido a tumores (IL-4RPep-1) y el miARN dirigido a AQP5 (miR-19b-3p) se coexpresaron en exosomas, que se secretaron a partir de células HEK293T en el medio acondicionado. Luego, el medio acondicionado entregó con éxito miR-19b-3p a las células MDA-MB-231 y disminuyó significativamente la expresión de la proteína AQP5 y la migración de las células cancerosas.

    La transfección transitoria de miARN en células MDA-MB-231 aumentó notablemente el nivel relativo de miARN (Figura 2A). Después de la administración del respectivo mimetismo de miARN en las células MDA-MB-231, el nivel de expresión relativo de miR-1226-3p con respecto al tratamiento con ARNip de control negativo se volvió muy alto (928 veces), lo que contrasta con los cambios. en los niveles de expresión de miR-19a-3p (53 veces) y miR-19b-3p (201 veces). Las diferencias en los niveles celulares entre los imitadores de miARN después de la transfección de la misma cantidad de cada imitador de miARN podrían deberse a la diferencia en el nivel de expresión endógena de cada miARN, ya que los cambios de pliegue relativo se estimaron en comparación con el nivel de miARN endógeno. De hecho, un perfil previo de miARN de alto rendimiento basado en el análisis de ARN-seq (GSE108286) demostró que el nivel de expresión endógena de miR-1226-3p (recuento de lecturas: 35) era mucho más bajo que el de miR-19a-3p (lea recuento: 2832) y miR-19b-3p (recuento de lectura: 5055) en celdas MDA-MB-231. Sin embargo, a pesar del gran aumento en los niveles de miARN después de la transfección del respectivo mimetismo de miARN, debe tenerse en cuenta que solo una cantidad limitada de mimetismo de miARN podría desempeñar un papel en la regulación de los genes diana. De manera consistente, estudios recientes revelaron que el incremento en la expresión de miARN después de la transfección transitoria de miARN mimético no representaba el nivel de miARN auténticamente activo, ya que la población de miARN que podía interactuar con el complejo RISC era limitada. 52 La Figura 2B mostró que la expresión del ARNm de AQP5 disminuyó notablemente por la transfección mímica de miR-1226-3p. Los resultados indicaron que es probable que miR-1226-3p esté involucrado en la degradación del ARNm de AQP5 que condujo a una disminución en la expresión proteica de AQP5. Otra posibilidad es que miR-1226-3p posiblemente se dirija a la 3ʹ-UTR de los genes reguladores de AQP5 que inhiben la transcripción de AQP5. Sin embargo, es necesario explorar los objetivos putativos de miR-1226-3p, que podrían regular la transcripción de AQP5.

    miR-1226-3p se encuentra en 3p21.31 (cromosoma 3: 47,849,555-47,849,629) y la secuencia de miR-1226-3p es UCACCAGCCCUGUGUUCCCUAG. miR-19a-3p y miR-19b-3p se encuentran en el 13q31.3 (cromosoma 13: 91,350,891-91,350,972 y 91,351,192-91,351,278, respectivamente) y tienen las secuencias UGUGCAAAUCUAUGCAAAACUGA y UGUGCAAAUCCAUGCAAAACUGA, respectivamente, que muestran una diferencia de un solo nucleótido, respectivamente. (undécimo nucleótido: U o C). miR-19a-3p y miR-19b-3p retienen las mismas secuencias semilla y comparten genes diana comunes (nueve genes diana comunes en la vía de la unión gap, microT & gt 0.8 y PAG & lt .05, Tabla 2). En el presente estudio, tres secuencias diana de miR-1226-3p, que fueron predichas por DIANA-tools, no respondieron al imitador de miR-1226-3p en células MDA-MB-231, mientras que la expresión de la proteína AQP5 disminuyó significativamente. Por tanto, se podría especular que puede haber otras secuencias diana en la 3ʹ-UTR del ARNm de AQP5 que respondan a miR-1226-3p. miR-19a-3p y miR-19b-3p tienen secuencias de semillas comunes. Sin embargo, miR-19b-3p redujo significativamente la actividad luciferasa en las células MDA-MB-231 que expresan la secuencia diana 2 (Figura 2C, D), mientras que miR-19a-3p no lo hizo. Este hallazgo sugirió que miR-19b-3p podría interactuar directamente con el 3ʹ-UTR del ARNm de AQP5 y regular la expresión de AQP5 al interrumpir el proceso de traducción del ARNm de AQP5. Según el análisis de DIANA-herramientas, un nucleótido en el miR-19b-3p (citosina, C en el undécimo nucleótido) es más complementario que un nucleótido en el miR-19a-3p (uracilo, U en el undécimo nucleótido), por lo tanto, miR-19b-3p es posiblemente más reactivo a la secuencia diana 2. Aunque la transfección mimética de miR-19a-3p no mostró una disminución en la actividad luciferasa, la disminución significativa observada en la expresión de la proteína AQP5 podría sugerir que miR-19a-3p también podría interactuar con otra diana inexplorada secuencias en el 3ʹ-UTR del ARNm de AQP5. Además, es posible que miR-19a-3p se dirija a otros genes que pueden regular la traducción de AQP5.

    La evidencia anterior mostró que miR-1226, miR-19a y miR-19b están involucrados en la regulación de proteínas relacionadas con el cáncer. Se informó que miR-1226 desempeña un papel como supresor de tumores a través de la regulación a la baja de la expresión de mucina 1 en las células de cáncer de mama (MCF-7 y MCF-10A) mediante la interacción con el 3ʹ-UTR de la mucina 1. 53 miR-19a- Se informó que 3p tenía como objetivo FOSL1 gen que codifica el antígeno 1 (FRA-1) relacionado con el factor de transcripción Fos en macrófagos asociados a tumores que potencian la migración y la invasión de células de cáncer de mama. 54 Además, miR-19a-3p interactuó directamente con el 3ʹ-UTR del factor tisular (el iniciador principal de la coagulación) y redujo la migración y la invasión de las células de cáncer de colon (LoVo y DLD1). 54 En los tejidos obtenidos de pacientes con cáncer gástrico, la expresión de miR-19b disminuyó significativamente en comparación con los tejidos adyacentes al tumor. 55 La tasa de supervivencia general y la tasa de supervivencia libre de enfermedad fueron significativamente más bajas en pacientes con cáncer gástrico con menor expresión de miR-19b. Además, miR-19b-1 sobreexpresado de forma estable en células MDA-MB-231 dio lugar a una detención del crecimiento tumoral en el modelo de ratón mediante la regulación de la actividad angiogénica. 56

    De acuerdo con los estudios antes mencionados, demostramos que la transfección de imitadores de miR-1226-3p, miR-19a-3p y miR-19b-3p atenuó notablemente la migración de células MDA-MB-231 en respuesta a las condiciones quimiotácticas ( Figura 3A, B). Se ha demostrado que la estimulación de LDL induce la proliferación celular y la migración de células MDA-MB-231, 39 y también hemos demostrado previamente que las LDL estimulan la migración de células MDA-MB-231. 44 En este estudio, mientras que el tratamiento con LDL (50 μg / mL, 24 horas) aceleró la migración de células MDA-MB-231, se vio obstaculizada significativamente por miR-1226-3p, miR-19a-3p y miR-19b-3p mimic transfección (40 nM, 48 horas, Figura 3C, D). El ensayo de migración de células Transwell mostró que la migración celular de células MDA-MB-231 transfectadas transitoriamente con miR-19b-3p solo estaba más impedida (Figura 3B), en comparación con el enfoque que usa IL-4RPep-1 y miR-19b-3p (Figura 6D). Este hallazgo podría explicarse por los diferentes niveles de expresión de miR-19b-3p (Figura 2A frente a Figura 6A) y, en consecuencia, los niveles de expresión de AQP5 fueron diferentes (Figura 1D frente a Figura 6B). Además, en términos de la dosis de miARN, usamos una dosis mayor de miARN (80 nM) en lugar de una dosis menor (40 nM) en los experimentos para estudiar si el medio de cultivo que contiene exosomas que expresan IL-4RPep-1 y miR- 19b-3p podría afectar la migración celular por las siguientes razones. Cuando miR-19b-3p (40 nM) se transfectó directamente a células MDA-MB-231, el nivel de expresión de miR-19b-3p aumentó en

    200 veces en las células (Figura 2A). Por el contrario, como se muestra en la Figura 5D, la carga de miARN (40 nM) en exosomas que expresan IL-4RPep-1 en células HEK293T dio como resultado un aumento significativo de miR-19b-3p en los exosomas, pero fue solo 8.8 - aumento de veces en comparación con las células HEK293T de control o aumento de 12,3 veces en comparación con las células HEK293T transfectadas con el vector IL-4RPep-1. Además, como se muestra en la Figura 6A, las células MDA-MB-231 tratadas con medio acondicionado recogido de células HEK293T cotransfectadas con el vector pDisplay-IL-4RPep-1 y el mimético miR-19b-3p (40 nM) mostraron un nivel aumentado de miR-19b-3p, pero fue un aumento de 4,1 veces. Por lo tanto, para el ensayo de migración celular en la Figura 6D, aumentamos la dosis de miR-19b-3p a 80 nM para la transfección a células HEK293T en lugar de 40 nM con el fin de entregar más miR-19b-3p a las células que migran a través de exosomas que contienen medio cultural.

    Anteriormente mostramos que la caída de AQP5 mediada por shRNA atenuó la migración celular de células MCF-7 in vitro y una mayor expresión de AQP5 en tejidos de cáncer de mama de pacientes se asoció con metástasis en los ganglios linfáticos in vivo. 13 Además del efecto directo de AQP5 sobre la migración de células de cáncer de mama, también demostramos que el Rac1 activado aumentaba en los tejidos de pacientes con cáncer de mama. Es probable que 16 Rac1, una GTPasa que participa de manera importante en la migración de células cancerosas, sea un objetivo posterior de AQP5 en el cáncer de mama. dieciséis DIANA-mirPath predijo que miR-1226-3p, miR-19a-3p y miR-19b-3p tienen genes diana en la ruta de la unión gap (Tabla 2) y se realizaron qRT-PCR e inmunotransferencia semicuantitativa para examinar el efecto de los miARN en estas diana genes. Como se muestra en la Tabla 3, la expresión de ARNm de NRAS y ITPR1 gen disminuyó significativamente después de la transfección de miR-1226-3p o miR-19b-3p en células MDA-MB-231, respectivamente. Curiosamente, la abundancia de proteínas de conexina-43, el producto de la GJA1 gen, se redujo significativamente después de la transfección de miR-19a-3p o miR-19b-3p. No se ha explorado la participación de estos miARN identificados en la vía de la unión gap y las interacciones de estos miARN identificados y los genes diana en la vía de la unión gap deben estudiarse en la migración y metástasis de células de cáncer de mama.

    Demostramos que la abundancia de proteína AQP5 en las células MDA-MB-231 disminuyó más en respuesta a la transfección de miR-19a-3p o miR-19b-3p, en comparación con la de miR-1226-3p (Figura 1B frente a Figura 1D). miR-19a-3p y miR-19b-3p no cambiaron la abundancia de las transcripciones de AQP5 (Figura 2B), lo que indica que es probable que miR-19a-3p y miR-19b-3p regulen la abundancia de la proteína AQP5 en el nivel de traducción . Además, el ensayo del gen indicador de luciferasa demostró que miR-19b-3p interactúa directamente con la 3ʹ-UTR del ARNm de AQP5 y conduce a la inhibición de la traducción (Figura 2D). Teniendo en cuenta el efecto distintivo de miR-19b-3p en la regulación de la abundancia de AQP5, se seleccionó y aplicó miR-19b-3p a los estudios de administración exosómica a la línea celular de cáncer de mama. En las células MDA-MB-231, el tratamiento con un medio acondicionado que contiene exosomas que expresan el mímico IL-4RPep-1 / miR-19b-3p dio como resultado un aumento significativo en el miR-19b-3p celular (

    4.1 veces, Figura 6A) y una disminución en la expresión de la proteína AQP5 por

    30% en comparación con el grupo de control (Figura 6C). Es ampliamente conocido que el receptor de interleucina-4 (IL-4R) se expresa en varias células cancerosas, incluido el carcinoma de células renales, el cáncer de mama, el cáncer de páncreas y el mesotelioma pleural maligno (MPM). 57-60 La expresión de IL-4R está sobreexpresada en el cáncer de páncreas maligno y MPM, y el aumento de la expresión de IL-4Rα, una subunidad principal de IL-4R, se asoció con una supervivencia deficiente en los pacientes, lo que indica que la sobreexpresión de IL- 4R está relacionado con la malignidad de las células cancerosas. 57, 60 Por tanto, los intentos terapéuticos mediados por IL-4R se han probado ampliamente. 36, 40 Por ejemplo, un estudio anterior demostró que los complejos de ARNip dirigidos a IL-4R interactuaban específicamente con IL-4R y se internalizaban de manera eficiente. 36

    En el presente estudio, demostramos que los exosomas que expresan el péptido de unión a IL-4R (IL-4RPep-1) entregan miARN de manera más eficiente, en comparación con los exosomas que expresan miARN solo (Figura 6E).Hemos diseñado exosomas y exosomas aislados para examinar la expresión de miR-19b-3p en el exosoma (Figura 5). Sin embargo, para la entrega de miARN a las células MDA-MB-231 no usamos los exosomas aislados sino que usamos el medio acondicionado que contiene el exosoma recolectado de las células HEK293T co-transfectadas con mimetismo de IL-4RPep-1 / miR-19b-3p. Esto se debió principalmente a la limitación técnica en la producción masiva y purificación de exosomas que expresan IL-4RPep-1 que contienen miARN, es decir, exosomas de bioingeniería. Se ha reconocido que la disponibilidad de cantidades suficientes de exosomas para estudios en animales o ensayos clínicos es una de las limitaciones de los exosomas como agentes terapéuticos. 61 Otras limitaciones son la falta de métodos para el aislamiento de poblaciones homogéneas de exosomas y la ineficacia en función de los costos. 61, 62 Se necesitan estudios futuros para crear líneas celulares diseñadas por ingeniería genética, que produzcan tanto IL-4RPep-1 como miARN de manera estable. Sin embargo, como se muestra en la Figura 6A, qRT-PCR reveló que miR-19b-3p se administró con éxito a las células MDA-MB-231 cuando las células se trataron con medio acondicionado recogido de IL-4RPep-1 / miR-19b-3p mimic- células HEK293T cotransfectadas. Además, como se muestra en la Figura 6B, la expresión de la proteína AQP5 disminuyó significativamente cuando las células MDA-MB-231 se trataron con medio acondicionado recogido de células HEK293T co-transfectadas con mimetismo IL-4RPep-1 / miR-19b-3p durante 48 horas. Por lo tanto, estos datos indicaron que el medio acondicionado recogido de células HEK293T co-transfectadas con imitación de IL-4RPep-1 / miR-19b-3p contenía exosomas que expresaban miR-19b-3p, que liberaban miR-19b-3p y disminuían la expresión de la proteína AQP5 en Células MDA-MB-231.

    Los exosomas aislados de células HEK293T no transfectadas y células HEK293T transfectadas con el vector pDisplay que expresa IL-4RPep-1 mostraron la expresión de TSG101 y CD63 y en su mayoría tenían un tamaño & lt200 nM (Figura 5C). Es importante destacar que la distribución de tamaño de las vesículas extracelulares en el medio acondicionado recogido de las células HEK293T [no transfectadas, transfectadas con IL-4RPep-1 o IL-4RPep-1 / miR-19b-3p mimic-cotransfectadas] fue en su mayoría & lt200 nm, que no era diferente de los exosomas aislados (Figura 5E). Sin embargo, en contraste con los exosomas aislados, también mostraron fracciones menores que tenían rangos & gt200 nm de tamaño, lo que sugiere que podría haber otras vesículas extracelulares o factores en el medio de cultivo que podrían afectar los cambios en la expresión de AQP5 y esto debe explorarse en Estudios futuros.

    Curiosamente, cuando las células cancerosas se trataron con un medio que contenía exosomas durante un período más corto, el exosoma que expresaba IL-4RPep-1 podría entregar miARN de manera más eficiente a las células receptoras mediante endocitosis mediada por receptores. Por el contrario, con una duración más prolongada del tratamiento, no era probable que la liberación de miARN por exosomas dependiera de la expresión del péptido que apunta al tumor en la superficie de los exosomas. Por lo tanto, especulamos que el efecto de la endocitosis mediada por receptores podría ser anulado por otros mecanismos, incluida la fusión, la micropinocitosis o la fagocitosis, que son conocidas por las formas de captación de exosomas. 63 En la etapa actual, una aplicación de exosomas que expresan IL-4RPep-1 cargados con miARN a modelos de enfermedades animales tiene una limitación debido a las dificultades de producción masiva y purificación de exosomas que expresan IL-4RPep-1 que contienen miARN, que necesita ser explorado más a fondo.

    En resumen, identificamos nuevos miARN dirigidos a AQP5 y examinamos su papel en la regulación de la expresión de AQP5 y la migración de células de cáncer de mama. Los efectos de los miARN dirigidos a AQP5 se revelaron en células de cáncer de mama humano mediante la liberación de exosomas de bioingeniería que coexpresan miARN dirigidos a AQP5 y un péptido (CRKRLDRNC: IL-4RPep-1) dirigido al IL-4R, que se expresa abundantemente en la mama. Células cancerígenas.


    Ver el vídeo: Endocitosis: Mediada por receptores. (Agosto 2022).