Información

10.E: Marcadores moleculares y rasgos cuantitativos (ejercicios) - Biología

10.E: Marcadores moleculares y rasgos cuantitativos (ejercicios) - Biología


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Estos son ejercicios de tarea para acompañar el TextMap "Online Open Genetics" de Nickle y Barrette-Ng. Incluye el estudio de los genes, en sí mismos, cómo funcionan, interactúan y producen las características visibles y medibles que vemos en los individuos y poblaciones de especies a medida que cambian de una generación a la siguiente, con el tiempo y en diferentes entornos.

Preguntas de estudio:

10.1 Se han identificado tres polimorfismos diferentes en un locus de marcador molecular particular. Un solo par de cebadores de PCR amplificará un fragmento de 50 pb (B2), un fragmento de 60 pb (B3), o un fragmento de 100 pb (B4).

Dibuje las bandas de PCR que se esperarían si estos cebadores se usaran para amplificar el ADN de individuos con cada uno de los siguientes genotipos:

a) B2B2

B) B4B4

C) B2B3

D) B2B4

10.2 Además de los cebadores utilizados para genotipar el locus B (descrito anteriormente), un par de cebadores separados pueden amplificar otro locus SSR polimórfico MI, con un producto de 60 pb (mi1) o 90 pb (mi2) producto. Se extrajo ADN de seis individuos (# 1- # 6), y el ADN de cada individuo se usó como plantilla en reacciones de PCR separadas con cebadores para cualquiera de los locus. B o cebadores para locus mi, y los productos de PCR se visualizaron en geles electroforéticos como se muestra a continuación.

Según los siguientes patrones de bandas de PCR, ¿cuál es el genotipo completo de cada uno de los seis individuos?

10.3 Con base en los genotipos que registró en la Pregunta 10.2, ¿puede determinar cuál de los individuos podría ser padre del individuo # 1?

10.4 Aquí está parte de la secuencia de ADN de un cromosoma:

TAAAGGAATCAATTACTTCTGTGTGTGTGTGTGTGTGTGTGTGTTCTTAGTTGTTTAAGTTTTAAGTTGTGA

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

ATTTCCTTAGTTAATGAAGACACACACACACACACACACACACACAAGAATCAACAAATTCAAAATTCAACACT

Identifique las siguientes características en la secuencia:

a) la región del fragmento que es más probable que sea polimórfica

B) cualquier secuencia simple se repite

C) los mejores sitios de destino para los cebadores de PCR que podrían usarse para detectar polimorfismos en la longitud de la región de repetición de secuencia simple en diferentes individuos

10.5 En una planta diploide en particular, el color de la semilla es un rasgo poligénico. Si las plantas de reproducción verdadera que producen semillas rojas se cruzan con plantas de reproducción verdadera que producen semillas blancas, la F1 produce semillas de color intermedio (es decir, rosa). Cuando una F1 la planta se autofecunda, se observan semillas blancas en la próxima generación. ¿Cuántos genes están involucrados en el color de la semilla para cada una de las siguientes frecuencias de semillas blancas en la F2 ¿Generacion?

a) 1/4 semillas blancas

B) 1/16 semillas blancas

C) 1/64 semillas blancas

D) 1/256 semillas blancas

10.6 Si la altura en los humanos es un rasgo poligénico, explique por qué ocasionalmente sucede que dos padres altos tienen un hijo que crece mucho más bajo que cualquiera de ellos.

10.7 En el mapeo de rasgos cuantitativos (QTL), los investigadores cruzan dos padres que difieren en la expresión de algún rasgo cuantitativo, luego permiten que los cromosomas de estos padres se recombinen al azar y, después de varias generaciones de endogamia, produzcan una gran cantidad de descendientes ("líneas endogámicas recombinantes" ). Debido a que la posición de los cruces es aleatoria, cada uno de los descendientes contiene una combinación diferente de regiones cromosómicas de cada uno de los dos padres. Luego, los investigadores usan marcadores moleculares para determinar qué regiones cromosómicas tienen la mayor influencia en el rasgo cuantitativo, p. Ej. en la descendencia alta, ¿qué regiones cromosómicas provienen siempre del padre alto?

Imagine que se han identificado dos cepas de ratones que difieren en el tiempo necesario para completar un laberinto, lo que puede ser una indicación de inteligencia. El tiempo para completar el laberinto es hereditario y estas cepas parentales "se reproducen fielmente" durante el mismo tiempo de finalización en cada generación. Imagine también que sus cromosomas son de diferentes colores y podemos rastrear la herencia de regiones cromosómicas de cada padre en función de este color.

Con base en los siguientes diagramas de un cromosoma de cada individuo en un árbol genealógico, identifique una región cromosómica que pueda contener un gen que afecta el tiempo para completar un laberinto. El tiempo de cada individuo se muestra debajo de cada cromosoma. Suponga que todos los individuos son homocigotos para todos los loci.

Padres:

Individuos seleccionados de entre la progenie F8 de los padres anteriores:

10.8 En una situación más realista (en comparación con la pregunta 7), en la que no puede distinguir el origen parental de diferentes regiones cromosómicas solo por la apariencia de los cromosomas, explique cómo podría identificar qué padre era la fuente de una región particular de un cromosoma en recombinantes. descendencia.


Marcadores moleculares y mejoramiento molecular en plantas

El advenimiento de las técnicas moleculares jugó un papel importante en el aumento de nuestro conocimiento de la genética de los cereales y el comportamiento de la genómica de los cereales. Si bien los marcadores RFLP han sido la base para la mayoría del trabajo en plantas de cultivo, se han generado marcadores valiosos a partir de RAPD y AFLP.

Recientemente, también se han desarrollado otros marcadores moleculares improvisados, como las repeticiones de secuencia simple (SSR), marcadores de microsatélites para las principales plantas de cultivo e inician un rápido avance tanto en el desarrollo de marcadores como en la implementación en el programa de mejoramiento.

El fitomejoramiento convencional lleva mucho tiempo y depende de las condiciones ambientales; por ejemplo, el mejoramiento para el desarrollo de nuevas variedades lleva entre ocho y doce años sin ninguna garantía de liberación de la variedad.

Por lo tanto, la cría es extremadamente entusiasta y está extremadamente interesada en las nuevas tecnologías de cría molecular que podrían hacer que todo este ejercicio de cría sea simple, rápido y eficiente. Esta tecnología también ofrece una selección de combinaciones deseables de rasgos.

Este enfoque puede establecer un vínculo entre el marcador molecular y los rasgos que se seleccionarán. Una vez que se complete este enfoque, permitiría que el proceso de reproducción se lleve a cabo en el laboratorio sin esperar la expresión de los genes para un fenotipo particular. Por ejemplo, la resistencia al patógeno vegetal se puede evaluar en ausencia de enfermedad. Cada tolerancia al estrés se puede analizar en las etapas de la plántula.

Selección asistida por marcadores (MAS):

(i) Mapeo de genomas vegetales:

Entre varias plantas de cultivo importantes, el arroz ha sido la planta objetivo de intensos estudios de mapeo. Sin embargo, la planta modelo Arabidopsis thaliana también se ha considerado para un estudio cartográfico extenso. Actualmente, también se ha completado el mapeo genético del arroz y Arabidopsis.

El mapeo más pequeño del tamaño del genoma es ideal como estrategia clave para la identificación de genes en el genoma complejo. Un marcador molecular como el marcador RFLP de especies estrechamente relacionadas es una buena marca fiable para construir un mapa de genes. El microsatélite es una herramienta útil para construir un mapa de genes para cada especie, mientras que los loci RFLP pueden usarse para mapear en mayor grado en taxones relacionados.

(ii) Enlace del marcador molecular al rasgo deseado:

La identificación de genes responsables del rasgo útil puede establecerse mediante un análisis de ligamiento con marcadores en un mapa genético del genoma vegetal. El marcador polimórfico se usa generalmente para identificar marcadores ligados. La búsqueda de marcadores vinculados se puede lograr mediante cierta técnica útil como el análisis segregado masivo (BSA). Esta técnica se utiliza para detectar polimorfismo entre dos muestras de ADN compuestas por la mayor parte de individuos de las poblaciones segregantes.

Por ejemplo, una muestra de ADN a granel de un individuo contiene el gen diana mientras que otro ADN del individuo carece de este gen. La muestra derivada de la población de segregación contiene los dos grupos que contienen la mayoría de los genes.

Es probable que el polimorfismo entre los bultos esté relacionado con los genes del rasgo. El análisis de enlazadores para marcador dominante (RAPD) y codominante (RFLP o microsatélite) requiere un análisis único separado del mapeo con F2 población.

(iii) Cruce de regreso acelerado:

La selección asistida por marcadores facilita la aceleración de todo el proceso de mejoramiento, lo que permite una liberación más temprana de la planta comercial. Esto se logra mediante dos métodos importantes como el retrocruzamiento acelerado y la selección de un rasgo deseado. La introducción de un rasgo deseable ha sido la opción favorita de los fitomejoradores sin alterar otro carácter.

Esto se puede lograr mediante cruces repetidos a la planta con el trasfondo genético requerido. Todas y cada una de las generaciones requieren la selección del rasgo introducido. Esto requiere un número mayor de cruces y un mayor número de generaciones, ya que los marcadores moleculares facilitan la selección de individuos con más genoma recurrente en cada generación. Puede limitar el programa de cría para que se complete con pocas generaciones.

Selección de un rasgo deseado:

Varios rasgos deseables pueden seleccionarse directamente mediante marcadores moleculares y pueden cribarse en cualquier etapa del programa de mejoramiento. Además del marcador disponible para uso rutinario, la conversión del marcador RFLP en marcador basado en PCR ayuda significativamente en la economía del uso molecular. Además, el uso de marcadores moleculares para la selección de frutos en el fitomejoramiento requiere la disponibilidad de una técnica sencilla y económica que proporcione resultados rápidos en la evaluación para la siguiente ronda de selección.

Mejoramiento molecular para resistencia:

El marcador basado en PCR se ha utilizado en el mejoramiento de la resistencia deseable a patógenos virales y fúngicos en plantas. El virus del mosaico amarillo de la cebada (Ba YMU) se ha considerado una enfermedad viral importante en Europa. Por lo tanto, el mejoramiento para la resistencia a la enfermedad es de especial importancia. Las aplicaciones de marcadores basados ​​en PCR estrechamente vinculados para la transmisión de genes de resistencia contra el virus del mosaico amarillo de la cebada son ahora exitosas y eficientes.

De manera similar, se ha avanzado en el mejoramiento de la resistencia al patógeno fúngico. El tizón de la cabeza por Fusarium es una enfermedad grave del trigo. Se han identificado marcadores moleculares muy parecidos al QTL principal implicado en la resistencia al tizón de la cabeza por Fusarium (FHB) y plantean la posibilidad de selección asistida por marcadores (MAS) para introducir alelos de resistencia en la variedad de trigo élite. Estas son algunas de las estrategias de seguridad en la cría. Las nuevas variedades combinaron un rendimiento de alto rendimiento y un alto nivel de resistencia al patógeno fusarium.

Identificación de líneas reproductivas:

En el germoplasma, el error de etiquetado puede conducir a artefactos de reproducción porque el manejo de un gran número de líneas puede crear problemas en la identificación de marcadores moleculares que se pueden utilizar para confirmar las líneas de reproducción.

Identificación de hibridación:

El marcador molecular se puede utilizar para identificar la naturaleza híbrida de un individuo, especialmente en especies autopolinizadoras. La producción de híbridos a través de un método híbrido no convencional como el híbrido somático también puede ser idéntica usando el análisis RAPD.

Pureza de las líneas de reproducción:

La mezcla accidental de semillas o la contaminación cruzada en las semillas recolectadas puede provocar la contaminación de las líneas de reproducción. Los marcadores moleculares se pueden utilizar para ayudar al establecimiento de líneas de reproducción puras y controlar la contaminación de la reproducción.

Predicción del rendimiento híbrido (heterosis):

El establecimiento de la distancia genética entre los progenitores utilizados en el cruce puede determinar el comportamiento de la hibridación. La distancia genética entre posibles padres se puede estimar empleando marcadores moleculares. Los marcadores de microsatélites RFLP se seleccionan como marcadores útiles para estas predicciones.

Identificación de germoplasma:

La identificación de varios recursos genéticos útiles de posibles progenitores para su uso en la reproducción requiere una técnica molecular adecuada. El marcador RAPD es una herramienta útil para la encuesta de germoplasma, por ejemplo, la encuesta de germoplasma de arroz usando RAPD muestra un vínculo entre la presencia de un marcador específico y loci de rasgos cuantitativos (QTL) para un carácter novedoso.

Marcadores bioquímicos:

Antes de la aparición de los marcadores moleculares, algunos de los experimentos anteriores se llevaron a cabo utilizando marcadores bioquímicos. Ciertas isoenzimas (o isoenzimas) se han empleado como marcadores bioquímicos en varios aspectos del fitomejoramiento y la genética debido a su importancia como marcadores naturales.

Algunos de los marcadores de isoenzimas bioquímicos comúnmente conocidos son esterasas, peroxidasas, deshidrogenasas, etc. Básicamente, estos marcadores son productos de expresión génica y se caracterizan por electroforesis y tinción. Por definición, las isoenzimas son múltiples formas moleculares de la misma enzima que ejecutan la misma función.

Son el producto de los diferentes alelos de uno o varios genes. En varios casos, las isoenzimas monoméricas y dímeras se emplean con mayor frecuencia debido a su proceso de segregación temprano. El marcador bioquímico y la evaluación mostraron que estos son marcadores codominantes. Aunque las isoenzimas son potencialmente un marcador confiable, su polimorfismo es, sin embargo, relativamente pobre dentro de una especie cultivada.


Home & gt Research & gt Book & gt Genética estadística de rasgos cuantitativos por Rongling Wu Chang-Xing Ma y George Casella

El libro presenta los conceptos y métodos básicos que son útiles en el análisis estadístico y el modelado de marcadores basados ​​en ADN y datos fenotípicos que surgen en la agricultura, la silvicultura, la biología experimental y otros campos. Se concentra en el análisis de vínculos de marcadores, construcción de mapas y mapeo de locus de rasgos cuantitativos (QTL) y asume antecedentes en análisis de regresión y enfoques de máxima verosimilitud. Los puntos fuertes de este libro residen en la construcción de modelos y algoritmos generales para el análisis de vínculos y el mapeo QTL en cualquier tipo de pedigrí cruzado iniciados con líneas endogámicas de cultivos y sistemas de modelos de plantas y animales o líneas exógenas en árboles forestales y especies de vida silvestre.

El libro incluye una descripción detallada de cada enfoque y la demostración paso a paso de análisis de ejemplo vivo diseñados para explicar la utilización y utilidad de los métodos estadísticos. El libro también incluye conjuntos de ejercicios y códigos de computadora para todos los análisis utilizados.

Este libro puede servir como libro de texto para graduados y estudiantes de último año en genética, agronomía, biología forestal, fitomejoramiento y ciencias animales. También será de utilidad para investigadores y otros profesionales en las áreas de estadística, biología y agricultura.

R ongling Wu es profesor asociado de estadística en la Universidad de Florida, Gainesville. Actualmente se desempeña como editor asociado de seis revistas de genética y bioinformática. Chang-Xing Ma es profesor asistente de bioestadística en la Universidad Estatal de Nueva York en Buffalo. George Casella es profesor distinguido de estadística y miembro distinguido del Instituto de Genética de la Universidad de Florida, Gainesville. Es miembro de la Asociación Estadounidense de Estadística y del Instituto de Ciencias Matemáticas, y autor de otros cuatro libros de estadística.

Este libro puede servir como libro de texto para graduados y estudiantes de último año en genética, agronomía, biología forestal, fitomejoramiento y ciencias animales. También será de utilidad para investigadores y otros profesionales en las áreas de estadística, biología y agricultura.

"Es una gran ayuda y orientación en el campo de los desarrollos estadísticos para el mapeo genético, sintetizado todo en un volumen que ayuda a construir un puente entre la genética y la estadística".

Lutz Bunger, Investigación genética, 89, 2007

". Este es un libro ideal para un joven investigador que busca un campo interesante y en desarrollo en el que adentrarse".

Revista internacional de estadísticas, abril de 2008

Prefacio

La mayoría de los rasgos de la naturaleza y de importancia para la agricultura se heredan cuantitativamente. Estos rasgos son difíciles de estudiar debido a la naturaleza compleja de su herencia. Sin embargo, los desarrollos recientes de las tecnologías genómicas proporcionan un medio revolucionario para desentrañar los secretos de la variación genética en.

Estadisticas basicas

Ahora que hemos visto los conceptos básicos de la genética, pasamos a una introducción a las metodologías estadísticas que usaremos a lo largo de este libro. La mayoría de las inferencias estadísticas que haremos se basarán en el análisis de verosimilitud, y no solo nos ocuparemos de construir lo apropiado.

1.1 Introducción
1.2 Genes y cromosomas
1.3 Meiosis
1.4 Leyes de Mendel fs
1.5 Vinculación y mapeo
1.6 Interferencia
1.7 Genética cuantitativa
1.8 Genética molecular
1.9 SNP
1.10 Ejercicios
1.11 Nota

2.1 Introducción
2.2 Estimación de verosimilitud
2.3 Prueba de hipótesis
2.4 Ejercicios

03 Análisis de vínculos y construcción de mapas.

3.1 Introducción
3.2 Diseño experimental
3.3 Segregación mendeliana
3.4 Patrones de segregación en una familia de hermanos completos
3.5 Análisis de dos puntos
3.6 Análisis de tres puntos
3.7 Ordenación de locus y verosimilitud multilocus
3.8 Estimación con muchos loci
3.9 Probabilidades de mezcla y probabilidades de orden
3.10 Funciones de mapa
3.11 Ejercicios
3.12 Notas: Algoritmos y software para la construcción de mapas

04 Un modelo general para el análisis de vinculación en cruces controladas.

4.1 Introducción
4.2 Marcadores totalmente informativos: un modelo de diploma
4.3 Marcadores totalmente informativos: un modelo de genotipo
4.4 Modelado conjunto del vínculo, el diploma parental y el orden genético
4.5 Marcadores parcialmente informativos
4.6 Ejercicios
4.7 Notas

05 Análisis de ligamiento con líneas endogámicas recombinantes.

5.1 Introducción
5.2 EIR por Selfing
5.3 RIL por apareamiento entre hermanos
5.4 Reducción de sesgo
5.5 RIL de múltiples vías
5.6 Ejercicios
5.7 Nota

06 Análisis de vinculación para marcadores distorsionados y mal clasificados

6.1 Introducción
6.2 Viabilidad diferencial gamética
6.3 Viabilidad diferencial cigótica
6.4 Clasificación errónea
6.5 Simulación
6.6 Ejercicios

07 Consideraciones especiales en el análisis de vínculos

7.1 Introducción
7.2 Análisis de vinculación con un pedigrí complicado
7.3 Análisis de información de marcadores dominantes
7.4 Ejercicios

08 Análisis de marcadores de fenotipos.

8.1 Introducción
8.2 Modelo de regresión QTL
8.3 Análisis en el marcador
8.4 Alejarse del marcador
8.5 Cálculo de potencia
8.6 Análisis de interacción de marcadores
8.7 Análisis de marcadores de genoma completo
8.8 Ejercicios

09 La estructura del mapeo QTL.

9.1 Introducción
9.2 El modelo de la mezcla
9.3 Estructura genética poblacional del modelo de mezcla
9.4 Estructura genética cuantitativa del modelo de mezcla
9.5 Configuración experimental del modelo de mezcla
9.6 Estimación en el modelo de mezcla
9.7 Algoritmos computacionales para el modelo de mezcla
9.8 Ejercicios

10 Mapeo de intervalos con análisis de regresión.

10.1 Introducción
10.2 Modelo de regresión lineal
10.3 Mapeo de intervalos en el retrocruzamiento
10.4 Mapeo de intervalos en un F2
10.5 Observaciones
10.6 Ejercicios

11 Mapeo de intervalos por enfoque de máxima verosimilitud.

11.1 Introducción
11.2 Mapeo de intervalos QTL en un retrocruzamiento
11.3 Prueba de hipótesis
11.4 Mapeo de intervalos QTL en un F2
11.5 Factores que afectan la detección de QTL
11.6 Procedimientos para el mapeo QTL
11.7 Ejercicios

12 Análisis de umbral y precisión.

12.1 Introducción
12.2 Determinación del umbral
12.3 Precisión de la estimación de parámetros
12.4 Intervalos de confianza para la ubicación de QTL
12.5 Ejercicios

13.1 Introducción
13.2 Mapeo de intervalo compuesto para un retrocruzamiento
13.3 Mapeo de intervalo compuesto para un F2
13.4 Una justificación estadística del mapeo de intervalo compuesto
13.5 Comparaciones entre mapeo de intervalo compuesto y mapeo de intervalo
13.6 Mapeo de intervalos múltiples
13.7 Ejercicios

14 Cartografía QTL en pedigrí exógenos.

14.1 Introducción
14.2 Un modelo de efectos fijos para una familia de hermanos completos
14.3 Modelo de mapeo de efectos aleatorios para un pedigrí complicado
14.4 Ejercicios


Discusión

En este estudio, diseñamos una estrategia para realizar análisis de retratos múltiples. En lugar de analizar conjuntamente todos los rasgos disponibles, propusimos seleccionar un subconjunto de rasgos informativos y analizar los rasgos seleccionados mediante un enfoque de múltiples retratos. Usando simulaciones y datos reales, demostramos que nuestro método propuesto tiene el potencial de lograr un poder estadístico óptimo. Hasta donde sabemos, esta es la primera vez que se propone la selección de variables para el mapeo QTL de múltiples retratos. Esperamos que nuestro método propuesto tenga aplicaciones prácticas. Por ejemplo, generalmente nos interesan las variantes genéticas que subyacen a características económicamente importantes como el rendimiento, el contenido de proteínas, los atributos de calidad y la resistencia a las enfermedades en un programa de reproducción. Estos rasgos tienden a estar correlacionados, y el análisis de múltiples retratos es preferible al análisis de un solo rasgo, como lo ejemplifica Singh. et al. (2012), quien recientemente estudió varias enfermedades del trigo. Entonces, nuestro enfoque no solo es capaz de lograr un poder óptimo en el marco del análisis de múltiples retratos, sino que también es capaz de revelar mejor los rasgos que son relevantes para el QTL identificado, que pueden no ser deseablemente entregados por un análisis de un solo rasgo o un análisis conjunto completo ( consulte la sección 9 en el archivo S1 para obtener más información).

Hay una serie de situaciones en las que nuestro método propuesto puede resultar útil. Primero, cuando el número de rasgos es mayor que el tamaño de la muestra (p.ej., datos de expresión de miles de genes disponibles), se debe seleccionar un subconjunto de rasgos si se implementa el análisis de múltiples retratos sin regularización de parámetros, ya que incluir todos los rasgos no es factible debido a los grados limitados de libertad. La contracción puede superar las grandes pag, pequeña norte Problema sin embargo, el cálculo puede ser un problema serio en el marco del análisis multivariado donde la manipulación de la matriz, como la inversión, además de la elección de un parámetro de regularización, típicamente está involucrada. Las estrategias para aplicar mejor el método propuesto a grandes cantidades de datos siguen siendo un tema de investigación interesante (sección 9 del archivo S1). En segundo lugar, el método propuesto también es aplicable a datos en los que el número de rasgos es grande y estamos interesados ​​en un pequeño subconjunto de los rasgos más relevantes. Por ejemplo, en los datos de expresión génica, es posible que nos interese saber qué genes están más influenciados por un eQTL (si corresponde). Si bien el análisis de múltiples retratos identifica típicamente QTL asociado con un grupo de rasgos sin revelar fácilmente qué rasgos están asociados con el QTL, la selección de variables elige los rasgos que son estadísticamente más significativos y, por lo tanto, más probablemente involucrados en un proceso biológico (sección 9 en el Archivo S1). En tercer lugar, la información de la selección de variables también puede ser útil cuando probamos otras hipótesis biológicas como la pleiotropía. Suponga que no se selecciona un rasgo (es posible que se requieran múltiples rondas de selección, consulte la sección 9 en el Archivo S1 para obtener más información), entonces el QTL es insignificante o no tiene ningún efecto. No es necesario observar la pleiotropía si no se selecciona ninguno de los dos rasgos, y podemos proceder a probar la pleiotropía sin dificultad si se seleccionan los dos rasgos.

La selección de variables es una técnica de reducción de datos. Comparamos nuestro método propuesto con otro enfoque de reducción de datos, a saber, el análisis de componentes principales (Weller et al. 1996), y demostró con datos reales que nuestro método lo superó en términos de poder estadístico. Hay otras desventajas del análisis de componentes principales. Primero, no es obvio qué rasgos están asociados con el QTL detectado. En segundo lugar, se plantea la cuestión de cuántos componentes principales deben analizarse. En los datos de e-trait, parecía apropiado analizar las primeras cuatro variables de componentes principales, pero la séptima y la octava, que representaban pequeñas proporciones de la varianza total, se encontraban entre las que identificaban QTL (Figura S4 y Figura S5 en el Archivo S1). . El poder estadístico tenderá a ser mucho menor en la mayoría de los loci si observamos solo las primeras cuatro variables componentes principales (datos no mostrados).

Se puede intentar agrupar los rasgos en función de las correlaciones y luego analizar los rasgos agrupados mediante un análisis de múltiples retratos. Dado que el poder del análisis de múltiples retratos depende tanto de los efectos de QTL como de la estructura de correlación, no es posible que el análisis de rasgos agrupados funcione mejor en loci de diferentes efectos de QTL. Por el contrario, la selección de variables selecciona dinámicamente los rasgos de acuerdo con los efectos de QTL y las correlaciones entre los rasgos y el análisis de múltiples retratos de los rasgos seleccionados en su mayoría funciona bien, y nuestro procedimiento de selección propuesto puede explotar completamente los datos para proporcionar la mejor potencia. Además, cómo agrupar los rasgos y determinar el número de grupos tendrá un impacto en los resultados. En términos de poder estadístico para los datos de e-trait, el análisis de los rasgos agrupados parecía estar en algún lugar entre el análisis de un solo rasgo y el análisis de múltiples rasgos de todos los rasgos (Figura 3 y sección 7 del Archivo S1).

Introdujimos el enfoque de selección de variables utilizando el estadístico (1) pero no tenemos que depender de él para realizar la selección de variables. La estadística de razón de máxima verosimilitud basada en modelos es más flexible y permite la inclusión de QTL identificados como covariables en la selección de variables sin ningún problema. Entonces podemos identificar múltiples QTL uno tras otro como en el mapeo de múltiples QTL de un solo rasgo. Sin embargo, dado que la selección de variables puede asociar diferentes rasgos con diferentes QTL, una pregunta puede ser cómo incluir mejor los QTL identificados como covariables. Otras preguntas incluyen cómo determinar los límites adecuados para reclamar QTL, especialmente cuando varía el número de rasgos en consideración. Finalmente, también será útil extender nuestro método propuesto para incorporar consideraciones prácticas como la interacción genotipo por ambiente y la variación poligénica (Singh et al. 2012).


Resultados

Las estimaciones generales de diferenciación genética de 14 loci de aloenzimas polimórficas (FS T) y tres rasgos cuantitativos (QS T), y las distribuciones de frecuencia de 1000 muestras de bootstrap se muestran en la Tabla 2 y la Figura 2, respectivamente. A juzgar por los intervalos de confianza de arranque del 95%, todos cuantitativos QS T las estimaciones fueron diferentes de las aloenzimas FS T, es decir, la expectativa neutral (FS T = 0,04795). Las pruebas de diferencia de medias fueron altamente significativas (PAG & lt 0,00) para todos los rasgos analizados. Las mayores divergencias se encontraron en forma de tallo (QS T = 0,97309) y altura total (QS T = 0,79093), siendo la supervivencia la estimación más baja (QS T = 0,73229). Las diferencias entre cuantitativos QS T y alozima FS T siguen siendo significativas cuando se suponen valores de heredabilidad en el rango 0-1 (Figura 3). Si se asumen valores de heredabilidad no constantes para cada rasgo cuantitativo, QS T porque la forma del tallo es siempre más alta que QS T para sobrevivir y solo es igual QS T para la altura total cuando la diferencia de heredabilidad para ambos rasgos es superior a 0,5, lo cual es poco probable. En el caso de supervivencia y talla, una diferencia de heredabilidad de 0,3 sería suficiente para igualar las estimaciones de diferenciación cuantitativa.

Distribuciones de frecuencia de alozima (FS T) y rasgo cuantitativo (QS T) diferenciación basada en 1000 muestras de bootstrap.

Q estimadoS T en el rango 0-1 de heredabilidad en sentido estricto. Las líneas punteadas indican intervalos de confianza del 95% obtenidos de 1000 réplicas de bootstrap.

Los modelos para comparaciones pareadas, ajustados para evitar posibles sesgos debido a la elección de marcadores moleculares, se muestran en la Tabla 3. El efecto de interacción (αβij) refleja la falta de proporcionalidad entre alozima (FS T*) y cuantitativo (QS T*) diferenciación. Si las dos medidas de diferenciación son proporcionales al conjunto de poblaciones comparadas, se supone la ausencia de selección que actúa sobre el rasgo cuantitativo y se atribuyen efectos incrementales a los diferentes tipos de datos analizados (Long y Singh, 1995). Hubo grandes diferencias en los patrones de subdivisión de la población para los rasgos analizados. Los efectos de interacción entre la forma del tallo y la altura total fueron muy significativos, mientras que la supervivencia QS T* era proporcional a la alozima FS T*. Las estimaciones de la diferenciación cuantitativa y de aloenzimas, y las desviaciones estándar basadas en bootstrap para cada conjunto de poblaciones comparadas se muestran en la Figura 4. Las divergencias más altas entre las comparaciones pareadas correspondieron a la forma del tallo cuyo patrón de subdivisión de la población era solo similar a las aloenzimas entre las poblaciones So1 y Bu ( par 6-7). La altura total mostró menores divergencias de las alozimas que de la forma del tallo, siendo similar en dos conjuntos: Cu1-Gu y So1-Bu (pares 4-5 y 6-7, respectivamente). Por el contrario, la supervivencia QS T* era proporcional a las aloenzimas FS T, sin mostrar interacción entre los pares de poblaciones comparadas.

Estimaciones de alozima (FS T*) y cuantitativo (QS T*) diferenciación y desviaciones estándar basadas en bootstrap para cada par de poblaciones comparadas. Los códigos de poblaciones se muestran en la Figura 1. Los números entre paréntesis indican una escala sin transformación angular.


Revisión: Genética y genómica en fisiología del ejercicio equino: una descripción general de las nuevas aplicaciones de la biología molecular como marcadores positivos y negativos de rendimiento y salud.

Unité de Biologie Integrative des Adaptations à l’Exercice, Francia y Génétique Animale et Biologie Intégrative, INRA, Francia.

Unité de Biologie Integrative des Adaptations à l’Exercice, Francia y Génétique Animale et Biologie Intégrative, INRA, Francia.

Resumen

La selección de la cría equina se ha desarrollado aplicando métodos genéticos cuantitativos para calcular la heredabilidad de rasgos complejos como el rendimiento en carreras o competiciones deportivas. Con el gran desarrollo de las biotecnologías, la genética molecular equina ha alcanzado la mayoría de edad. La reciente secuenciación del genoma equino por parte de un consorcio internacional fue un avance importante que tendrá un impacto en la genómica equina en un futuro próximo. Con el rápido progreso de la genética equina, están disponibles nuevas aplicaciones en la evaluación temprana del desempeño y la detección de marcadores de enfermedades. Muchas herramientas biomoleculares nuevas cambiarán la gestión de la selección de caballos, el diagnóstico y el tratamiento de enfermedades. El propósito de esta revisión es presentar nuevos desarrollos en genética y genómica equina para la evaluación del rendimiento y los marcadores de salud después de un breve resumen del conocimiento previo sobre los componentes genéticos de los rasgos de rendimiento del ejercicio.


Marcadores de ADN en el mejoramiento de plantas

Los marcadores genéticos se mantienen para una investigación detallada de cuestiones complejas en biología cuantitativa. El advenimiento de los marcadores de ADN, que amplía enormemente el número de marcadores genéticos disponibles, está permitiendo a los investigadores comenzar a aprovechar el potencial de esta tecnología, en beneficio tanto de la biología básica como de la productividad agrícola. Los marcadores genéticos hacen una contribución importante a las ciencias biológicas, especialmente a la agricultura, en el futuro previsible. Los marcadores de ADN pueden acelerar significativamente muchos esfuerzos de reproducción. Pueden proporcionar nuevos enfoques para algunos objetivos, que han resultado difíciles de lograr con técnicas clásicas, como la introgresión de rasgos valiosos de germoplasma exótico en cultivares domésticos. Este capítulo aborda las aplicaciones de los marcadores de ADN al fitomejoramiento. Los marcadores genéticos representan la variación genética, lo que permite estimar la relación entre diferentes genotipos y predecir qué apareamientos podrían producir combinaciones de genes nuevas y superiores.


10.E: Marcadores moleculares y rasgos cuantitativos (ejercicios) - Biología

Uso de la genómica para mejorar la calidad de la fruta

Claudio Meneses 1 y Ariel Orellana 1,2 *

1 Centro de Biotecnología & iacutea Vegetal, Facultad de Ciencias Biol & oacutegicas, Universidad Andr & eacutes Bello.
2 Centro FONDAP de Regulación Genómica.
Autor para correspondencia (*): Ariel Orellana. Avenida Rep & uacuteblica 217, Santiago, Chile. Teléfono: + 56 & # 452 & # 4526618628. Correo electrónico: [email protected]

Se necesitan nuevas variedades de frutas para satisfacer a los consumidores, y la industria se enfrenta a nuevos desafíos para responder a estas demandas. La aparición de herramientas genómicas está liberando información sobre polimorfismos que se pueden utilizar para acelerar los procesos de reproducción en especies que son difíciles de reproducir, dados los largos períodos de tiempo necesarios para obtener nuevas variedades. La presente revisión describe las etapas actuales de los esfuerzos en curso que se están realizando para aplicar estas tecnologías a fin de obtener variedades con calidad de fruto mejorada en especies de la familia de las rosáceas.

Palabras clave: Polimorfismos, selección asistida por marcadores, herramientas genómicas.

El mercado demanda fruta de mejor calidad. Además de aspectos importantes para los consumidores como el sabor, el aroma y la consistencia, entre otros, el mundo globalizado ha ampliado los lugares donde se producen y en ocasiones la fruta necesita ser transportada a largas distancias para llegar a sus mercados finales. Esto plantea un desafío, ya que la calidad de la fruta también tiene que responder al almacenamiento prolongado posterior a la cosecha sin afectar la calidad de la fruta. Finalmente, los efectos del cambio climático están perturbando las condiciones climáticas donde históricamente se han producido frutos, por lo tanto, las nuevas variedades también deben adaptarse mejor para crecer en condiciones más duras. La crianza es el principal proceso utilizado para obtener nuevas variedades. Sin embargo, se requieren nuevos enfoques para producir variedades de frutas que respondan a los desafíos emergentes. La identificación de determinantes moleculares, junto con la generación de marcadores de selección para rasgos de interés, ofrecen una oportunidad para responder a estos desafíos. En los últimos años se han secuenciado los genomas de algunas especies frutales de las Rosáceas (Velasco et al., 2010 Shulaev et al., 2011 Verde et al., 2013 Zhang et al, 2012a Wu, 2013), dando lugar a una gran expansión en la identificación de marcadores de selección que se puedan aplicar en los programas de mejoramiento para acelerar el desarrollo de variedades que respondan a los desafíos emergentes. En la presente revisión nos enfocamos en las nuevas tendencias que están surgiendo en relación al uso de herramientas genómicas y la identificación de marcadores de selección en especies de las Rosáceas.

CRÍA Y MARCADOR DE FRUTAS & # 45 SELECCIÓN ASISTIDA EN ROSACEAE

La Rosaceae contiene más de 100 géneros y 3000 especies. Es la tercera familia de plantas económicamente más importante en las regiones templadas (Dirlewanger et al., 2002), incluidas especies de importancia económica como la manzana. (Malus x domestica), Durazno (Prunus persica), fresa (Fragaria ananassa), ciruela (Prunus salicina), almendra (Prunus dulcis), pera (Pyrus communis), Ciruela europea (Prunus domestica) y cereza dulce (Prunus avium), entre otros. La producción mundial total de frutos comestibles rosáceos alcanzó alrededor de 145 millones de toneladas, con 998.000 hectáreas cosechadas en 2011 (FAO, 2013). Por ello, en los últimos 50 años se han llevado a cabo iniciativas para generar nuevas variedades de frutas que se adapten a las condiciones agronómicas locales y satisfagan los requerimientos del consumidor. En los últimos años, los programas de mejoramiento se han enfrentado a desafíos cada vez mayores, incluido el desarrollo de variedades mejoradas para rasgos que tienen un control genético complejo (rasgos cuantitativos). Estos programas deben producir resultados en el menor tiempo posible y también deben adaptarse a las condiciones climáticas agrícolas locales. Durante mucho tiempo los programas de mejoramiento enfocaron sus esfuerzos en desarrollar variedades con desempeño superior en términos de producción (rendimiento, tamaño promedio de fruto) y características comerciales (color de toda la superficie), con el fin de satisfacer los requerimientos del productor, sin considerar las necesidades de final. consumidores (calidad de la fruta). En la actualidad, la mejora de la calidad de la fruta es uno de los principales objetivos de los productores y obtentores de especies de Rosáceas, ya que el objetivo último de la industria es satisfacer a los consumidores. La expresión fenotípica de la mayoría de los rasgos de calidad de la fruta es cuantitativa. Se basan en procesos bioquímicos complejos que suelen estar determinados por la interacción de varios genes implicados en diferentes vías metabólicas, como el contenido de sólidos solubles, la acidez titulable, la firmeza y la jugosidad de la pulpa (Illa et al., 2010). La estrategia utilizada por la mayoría de los programas de mejoramiento se basa en la realización de cientos de cruces controlados para seleccionar entre miles de individuos algunos que exhiben los rasgos objetivo. Este enfoque ha tenido éxito en la producción de la mayoría de las variedades que hoy están disponibles en el mercado. Sin embargo, tiene una serie de desventajas, ya que esta estrategia es particularmente lenta y costosa en árboles frutales debido al tiempo requerido para obtener la producción de fruta (2 & # 453 años para melocotón y 3 & # 455 años para manzana) y los recursos mantener las plántulas en el campo durante los procesos de evaluación y selección. De hecho, se necesitan al menos 12 y 4520 años para obtener una nueva variedad de árbol frutal de Rosáceas. Por esta razón, el desarrollo de herramientas genómicas para apoyar la selección temprana de genotipos puede ser la clave para mejorar la eficiencia de los programas de mejoramiento.

USO DE HERRAMIENTAS GENÓMICAS PARA OBTENER MARCADORES PARA LA SELECCIÓN

Los avances en las tecnologías de secuenciación de ADN aceleraron el desenmarañamiento de genomas de diferentes especies hasta la fecha, se han secuenciado varios genomas de las Rosáceas. Cuadro 1 que incluye Malus x domestica (manzana), Fragaria vesca (fresa), Prunus persica (Durazno), Prunus mume y Pyrus bretschneider (Velasco et al., 2010 Shulaev et al., 2011 Verde et al., 2013 Zhang et al, 2012a Wu, 2013). Además, las secuencias de Prunus amygdalus (almendra) y Prunus avium (cereza dulce) se han puesto recientemente a disposición de la comunidad de investigación (http://genomicsdata.wsu.edu/public_access/index.php). La disponibilidad de estos genomas hizo más fácil volver a secuenciar el genoma de otros individuos de la misma especie e identificar polimorfismos o variantes estructurales presentes en sus genomas, como polimorfismos de un solo nucleótido (SNP), inserciones / deleciones (INDEL), variantes de número de copias. y translocaciones. Dado que los SNP son, con mucho, los polimorfismos más abundantes presentes en todos los genomas, la mayoría de los esfuerzos en la búsqueda de marcadores que puedan ser útiles en la selección de reproducción asistida se han dirigido a esta clase de polimorfismos. Los SNP están ampliamente distribuidos en el genoma y pueden ubicarse en regiones intergénicas o intragénicas. Los primeros intentos de identificar SNP utilizando enfoques de tecnologías de secuenciación comenzaron investigando su presencia en genes expresados ​​utilizando etiquetas de secuencia expresada (EST). Una característica interesante de los SNP ubicados en tecnologías ecológicamente racionales es la posibilidad de establecer un vínculo entre la genómica funcional y estructural. Sin embargo, existen algunas limitaciones cuando se utilizan tecnologías de secuenciación de baja cobertura, ya que el descubrimiento de SNP depende del nivel de expresión y es difícil obtener SNP para genes de baja expresión. Además, también pueden surgir algunos problemas al discriminar genes parálogos. A pesar de estas limitaciones, este enfoque demostró ser exitoso para identificar SNP en manzana (Chagne et al., 2008), almendra (Wu et al., 2008) y fresa (Bombarely et al., 2010). La aparición de las denominadas tecnologías de secuenciación de próxima generación (NGS) no solo mejoró la secuenciación genómica, sino que también hizo posible realizar análisis de transcriptomas con mayor cobertura (análisis de ARN y secuencias). Esta actualización metodológica amplió y mejoró la detección de polimorfismos en genes expresados. Así, se obtuvieron más de 2.000 SNP al comparar el transcriptoma de Bing y Rainier, dos cultivares de cereza (Koepke et al., 2012), y se detectaron más de 9.000 SNP en el transcriptoma de melocotón (Wang et al., 2013).

La secuenciación amplia del genoma de diferentes individuos amplió la identificación de polimorfismos. Este análisis tiene la ventaja de que, en teoría, podemos obtener una amplia heterogeneidad dentro de una especie dada, sin embargo, este es un proceso desafiante ya que muchos individuos que exhiben toda la diversidad de esa especie necesitan estar representados. Además, utilizando las tecnologías actuales no es posible volver a secuenciar todo el genoma de forma asequible. Sin embargo, para fines de reproducción, el uso de tecnologías NGS para obtener información genómica de aquellos individuos que podrían usarse como padres es suficiente para proporcionar información sobre polimorfismos que pueden ser marcadores útiles. Por ejemplo, en manzana, la secuenciación genómica de 27 cultivares llevó a la identificación de más de 2 millones de SNP (Chagne et al., 2012a) en peras, la secuenciación de tres cultivares europeos identificó más de 1 mil SNP (Montanari et al., 2013) en melocotón, la secuenciación de dos variedades obtuvo más de 6.000 SNP (Ahmad et al., 2011) mientras que un esfuerzo más reciente, secuenciando 56 accesiones de mejoramiento, identificó más de 1 millón de SNP (Verde et al., 2012).

Todo este esfuerzo de búsqueda de SNP se ha transformado en una colección de SNP polimórficos de diferentes especies, depositados en matrices de chips que han sido útiles para construir mapas genéticos de poblaciones de alta densidad. Más importante aún, estas matrices de chips son un paso relevante hacia la identificación de las regiones del genoma que son clave para definir rasgos agrícolas complejos (Verde et al., 2012 Chagne et al., 2012a Montanari et al., 2013).

¿CÓMO TRANSFORMAR UN POLIMORFISMO EN UN MARCADOR DE SELECCIÓN?

Una vez que los marcadores moleculares están disponibles, es necesario establecer un vínculo entre los marcadores genéticos y los rasgos de calidad de la fruta. Para ello, existen varias alternativas metodológicas que se han utilizado con relativo éxito y existen dos ampliamente aceptadas: el análisis de loci de rasgos cuantitativos (QTL) y el mapeo de asociaciones. Aunque estas estrategias son anteriores a la era del NGS, en la actualidad hay miles de polimorfismos disponibles en varias especies de árboles frutales de Rosaceae y estos pueden expandirse utilizando plataformas NGS. Toda esta información junto con la posibilidad de genotipar cientos de individuos, incluyendo segregantes de poblaciones o variedades de mapeo bi-parental, mejora la probabilidad de encontrar marcadores vinculados a rasgos debido a una mayor resolución de los mapas genéticos, la cobertura del genoma es mejor y la La variabilidad genética es abundante debido al número de individuos considerados en el análisis. Por tanto, los mapas de ligamiento genético, el análisis de QTL y los mapas de desequilibrio de ligamiento parecen proporcionar herramientas que permitirán la disección de rasgos genéticos complejos y la selección asistida por marcadores de rasgos de importancia económica.

Mapas de ligamiento genético y análisis QTL: un mapa de ligamiento puede pensarse como un 'mapa de ruta' de los cromosomas derivados de dos padres diferentes (Paterson, 1996) que indica la posición y las distancias genéticas relativas considerando la tasa de recombinación entre marcadores en los cromosomas. El uso más importante de los mapas de ligamiento es identificar regiones cromosómicas que contienen genes y QTL asociados con rasgos de interés. La construcción del mapa genético tiene tres pasos: i) generación de la población cartográfica, II) identificación de polimorfismos y iii) análisis de ligamiento de marcadores (Collard et al., 2005). Los QTL son regiones cromosómicas que contienen uno o más factores genéticos que son responsables de una fracción de la variación fenotípica de un rasgo cuantitativo (Tanksley, 1993). El análisis de QTL se basa en el principio de detectar una asociación entre fenotipos y genotipos de marcadores distribuidos en el genoma. Los marcadores se utilizan para dividir la población cartográfica en diferentes grupos genotípicos en función de la presencia o ausencia de un locus marcador particular y para determinar si existen diferencias significativas entre los grupos en relación con el rasgo que se está midiendo (Tanksley, 1993 Young, 1996).

Hasta hace poco, la mayoría de los marcadores utilizados en los análisis genéticos eran repeticiones de secuencia simple (SSR), sin embargo, su disponibilidad no es alta, por lo que la resolución de los mapas genéticos era baja. A pesar de esto, se han reportado QTL para el tiempo de floración y maduración, calidad de la fruta, arquitectura del árbol y resistencia a patógenos (Dirlewanger et al., 1996 Abbott et al., 1998 Dirlewanger et al., 1999 Etienne et al., 2002 Quilot et al.2004 Dirlewanger et al., 2006 Lambert et al., 2007 Ogundiwin et al., 2008 Dirlewanger et al., 2009). Además, se han reportado QTL para peso de fruta, contenido de sólidos solubles y acidez (Dirlewanger et al., 1999 Etienne et al., 2002 Verde et al., 2002 Dirlewanger et al., 2009), así como daño por frío (Cant & iacuten et al., 2010). Además, se llevaron a cabo análisis de QTL para el tamaño de la fruta en la manzana (Stoeckli et al., 2008 Kenis et al., 2008 Davoghalaere et al., 2012 Potts et al., 2013), acidez (Xu et al., 2012 Zhang et al. ., 2012b Kenis et al., 2008 Potts et al., 2013), contenido de sólidos solubles (Kenis et al., 2008 Potts et al., 2013), fecha de cosecha (Kenis et al. 2008) fecha de floración (Celton et al. ., 2012), madurez de frutos (Morimoto et al. 2013), número de frutos (Stoeckli et al., 2009), compuestos orgánicos volátiles (Zini et al., 2005 Dunemann et al., 2009 Dunemann et al., 2012 Khan et al. al., 2012 Chagne et al., 2012b Vogt et al., 2013 Costa et al., 2013), textura (King et al., 2000 King et al., 2001 Kenis et al., 2008 Costa et al., 2008 Costa et al., 2010 Longhi et al., 2012 Longhi et al., 2013), producción de etileno (Costa et al., 2014), contenido de vitamina C (Davey et al., 2006 Mellidou et al., 2012) y carne pardeamiento (Kenis et al., 2008 Di Guardo et al., 2013). Además, como el costo de la construcción del mapa era más alto, los esfuerzos se concentraron en unas pocas poblaciones cartográficas y, a menudo, se las consideró como progenies de referencia, pero estas poblaciones solo se segregaron para unos pocos rasgos. Por ejemplo, el mapa de referencia genética de Prunus (Dirlewanger et al., 2004) se construyó utilizando una población cartográfica obtenida del cruce interespecífico entre almendra y melocotón. Al principio esta población era muy apropiada, porque mostraba un alto nivel de polimorfismo y la mayoría de los marcadores sondeados eran polimórficos. Sin embargo, a pesar de la saturación del marcador, esta población no tiene fenotipos segregantes para la calidad del fruto.

En la actualidad, el descubrimiento de SNP mediante plataformas NGS es más rápido y económico por punto de datos. Además, se encuentran disponibles sistemas de genotipado SNP de alto rendimiento. Esto permite la generación de mapas genéticos saturados y la detección de QTL utilizando estas tecnologías. En melocotón, Eduardo et al. (2011), en el que inicialmente se construyeron mapas basados ​​en SSR sobre la población cartográfica Bolero x Oro A. Posteriormente, saturaron los mapas de Bolero y Oro A utilizando SNPs contenidos en la matriz Illumina 9,000 SNP v1 para melocotón (Verde et al., 2013). Así, se mapearon un total de 1,453 y 229 SNP en Bolero y Oro A, respectivamente (Eduardo et al., 2012). Sobre la base de este enfoque, se detectó la colocalización entre genes candidatos y los principales QTL: dos terpeno sintasas putativas y una lipoxigenasa (Lox) podrían estar involucradas en la biosíntesis de linalol, p & # 45menth & # 451 & # 45en & # 459 & # 45al y nonanal, respectivamente . La contribución de la matriz SNP ayudó a generar un mapa saturado y la resolución y cobertura mejoraron considerablemente. De manera similar, Longhi et al. (2012) en manzanas. Se saturaron dos mapas utilizando SNP que se identificaron durante un borrador de ensamblaje temprano (profundidad de secuenciación 4X) del esfuerzo de secuenciación del genoma Golden Delicious (Micheletti et. Al., 2011). A partir de este estudio, se han identificado genes candidatos para textura y maduración (Longi et al., 2012 Costa et al., 2014). En las cerezas, se utilizó la secuenciación NGS para descubrir SNP, proporcionando marcadores para estudios genéticos y genómicos. Se construyeron mapas genéticos de alta densidad de cuatro líneas parentales y dos poblaciones segregantes utilizando la matriz de SNP 6K de cereza RosBREED v1 (Klagges et al., 2013). Este es el primer paso para identificar genes que pueden estar involucrados en la calidad del fruto de esta especie.

Mapeo de asociaciones. Existe un interés creciente en utilizar el mapeo de asociación o el mapeo de desequilibrio de ligamiento (LD) para identificar genes responsables de rasgos complejos. Este enfoque es una nueva alternativa al análisis de ligamiento (cruces parentales bi & # 45) y ofrece tres ventajas: mayor resolución del mapa, menor tiempo de investigación ya que no es necesario desarrollar poblaciones segregantes para rasgos de interés y mayor número de alelos (Zhu et al. ., 2008). Además, el análisis de ligamiento está limitado por el bajo número de eventos de recombinación que ocurren en un mapeo de población bi-parental, mientras que el mapeo de asociación usa la recombinación histórica y la variación natural de un conjunto de accesiones que podrían representar la variación fenotípica total para muchos rasgos. Este enfoque se basa en el uso de información genotípica de marcadores genéticos distribuidos por todo el genoma para explicar las relaciones genéticas mediante pruebas de asociación. La relación genética determinada por el desequilibrio de ligamiento mide el grado de asociación no aleatoria entre alelos en diferentes loci, que también podría estar relacionado con un rasgo específico. El mapeo de asociación incluye i) selección de germoplasma, proporcionando la máxima variabilidad genética para un rasgo dado ii) genotipado de germoplasma iii) determinación de los fenotipos de los rasgos de interés iv) genotipado del germoplasma utilizando una gran cantidad de marcadores yv) análisis de asociación. En especies de plantas modelo como Arabidopsis (Aranzana et al., 2005 Tracy et al., 2006 Belo et al., 2008) y cultivos de importancia económica como el maíz (Andersen et al., 2005 Salvi, 2007), sorgo (Casa et al., 2007). al., 2008) y estudios de mapeo de asociación de cebada (Kraakman et al., 2006). En Rosaceae, Longhi et al. (2013) determinaron la LD entre los marcadores identificados dentro de la colección de cultivares de manzana, y los haplotipos para estos marcadores se asociaron con texturas de pulpa. Un estudio de genoma y asociación global n. ° 45 (GWAS) en 1200 manzanas (Malus x domestica Borkh.), Genotipadas usando la matriz de SNP de 8K, fue realizado por Kumar et al. (2013). Informaron la primera evaluación sistemática de las contribuciones relativas de diferentes regiones genómicas a varios rasgos relacionados con la calidad de la alimentación y la susceptibilidad a algunos trastornos fisiológicos. Se identificaron regiones cromosómicas con efectos significativos en varios rasgos. Se han realizado otros esfuerzos en el mapeo de asociaciones en pera (Inoue, et al., 2007 Iwata, et al., 2013) y melocotón (Aranzana et al., 2010), pero utilizando cientos de SSR. La disponibilidad de chips SNP debería mejorar sus descubrimientos.

Genomas secuenciados de algunos miembros de la familia de las Rosáceas, incluidos los SNP detectados en estas especies

OBSERVACIONES FINALES

Los estudios genómicos están identificando un número creciente de SNP. Esta información, combinada con el trabajo sobre la segregación de poblaciones, o mediante el uso de mapas de asociación, debería conducir a un número cada vez mayor de marcadores que se pueden utilizar en la selección temprana de variedades en los programas de mejoramiento. Sin embargo, para obtener marcadores que sean precisos en su predicción, es necesario realizar un gran esfuerzo en el fenotipado de aquellas características que son importantes tanto para los consumidores como para la industria. Además, estos enfoques también deberían llevarnos a la identificación de genes implicados en la determinación de los componentes moleculares implicados en la definición de rasgos complejos. Por lo tanto, otro producto importante de estos estudios será una mejor comprensión de la biología detrás de los procesos que llegan a nuestros sentidos.

AGRADECIMIENTOS

Este trabajo ha sido apoyado por FONDECYT # 11121396 FONDAP & # 45CRG 15090007 ICM P10 & # 45062 & # 45F PB 16.

LITERATURA CITADA

ABBOTT AG, RAJAPAKSE B, SOSINSKI B, LU ZX, SOSSEY & # 45ALAOUI K, GANNAVARAPU M, REIGHARD GL, BALLARD RE, BAIRD WV, SCORZA R, CALLAHAN A (1998) Construcción de mapas de ligamiento saturado de cruces de melocotón segregando para personajes que controlan la fruta Arquitectura de árboles de calidad y resistencia a plagas. Acta Hort 465: 41 y # 4549. [& # 160Links & # 160]

AHMAD R, PARFITT DE, FASS J, OGUNDIWIN E, DHINGRA A, GRADZIEL TM, LIN D, JOSHI NA, MARTINEZ & # 45GARCIA PJ, CRISOSTO CH (2011) Secuenciación del genoma completo de melocotón (Prunus persica L) para la identificación y selección de SNP. BMC Genomics 12. [& # 160Links & # 160]

ANDERSEN JR, SCHRAG T, MELCHINGER AE, ZEIN I, L & UumlBBERSTEDT T (2005) Validación de polimorfismos Dwarf8 asociados con el tiempo de floración en líneas endogámicas europeas de élite de maíz (Zea mays L). Theor Appl Genet 111: 206 & # 45217. [& # 160Links & # 160]

ARANZANA MJ, ABBASSI E, HOWAD W, AR & UacuteS P (2010) Estructura poblacional de variación genética y desequilibrio de ligamiento en variedades comerciales de melocotón. BMC Genetics vol 11:69. [& # 160Links & # 160]

ARANZANA MJ, KIM S, ZHAO K, BAKKER E, HORTON M, JAKOB K, LISTER C, MOLITOR J, SHINDO C, TANG C, TOOMAJIAN C, TRAW B, ZHENG H, BERGELSON J, DEAN C, MARJORAM P, NORDBORG M (2005) El mapeo de asociación de genoma y # 45 en Arabidopsis identifica genes de resistencia a patógenos y tiempo de floración previamente conocidos. PLoS Genet 1: e60. [& # 160Links & # 160]

BELO A, ZHENG P, LUCK S, SHEN B, MEYER DJ, LI B, TINGEY S, RAFALSKI A (2008) La exploración del genoma completo detecta una variante alélica de fad2 asociada con niveles elevados de ácido oleico en el maíz. Mol Genet Genomics 279: 1 y # 4510. [& # 160Links & # 160]

BOMBARELY A, MERCHANTE C, CSUKASI F, CRUZ & # 45RUS E, CABALLERO JL, MEDINA & # 45ESCOBAR N, BLANCO & # 45PORTALES R, BOTELLA MA, MU & NtildeOZ & # 45BLANCO J, S & AacuteNCHEZ & # 45SEVILLA y análisis de 2010 ALPUTA JF de fresa (Fragaria x ananasa) frutos y evaluación de su utilidad en estudios genéticos y moleculares. BMC Genomics 11: 503. [& # 160Links & # 160]

CASA AM, PRESSOIRA G, BROWN PJ, MITCHELL SE, ROONEY WL, TUINSTRAC MR, FRANKS CD, KRESOVICHA S (2008) Recursos comunitarios y estrategias para el mapeo de asociaciones en sorgo. Crop Sci 48: 30 y # 4540. [& # 160Links & # 160]

CANT & IacuteN CM, CRISOSTO CG, OGUNDIWIN EA, GRADZIEL T, TORRENTS J, MORENO MA, GOGORCENA Y (2010) Susceptibilidad a lesiones por frío en un melocotón intraespecífico & # 91 Prunus persica (L) Batsch & # 93 progenie. Biología y tecnología de poscosecha 58: 79 & # 4587. [& # 160Links & # 160]

CELTON JM, MART & IacuteNEZ S, JAMMES MJ, BECHTI A, SALVI S, LEGAVE JM, COSTES E (2012) Descifrando el determinismo genético de la fenología de los cogollos en las progenies de la manzana: una nueva visión de los efectos de los requisitos de frío y calor en las fechas de floración y los genes candidatos posicionales . Nuevo fitólogo 192: 378 & # 45392. [& # 160Links & # 160]

CHAGN & Eacute D, CROWHURST RN, TROGGIO M, DAVEY MW, GILMORE B, LAWLEY C, VANDERZANDE S, HELLENS RP, KUMAR S, CESTARO A, VELASCO R, PRINCIPAL D, REES JD, IEZZONI A, MOCKLER T, VILANHENS WEG E, GARDINER SE, BASSIL N, PEACE C (2012a) Genoma y validación de detección de SNP de todo el mundo y desarrollo de una matriz de SNP de 8K para Apple. PLoS ONE 7 (2): e31745. [& # 160Links & # 160]

CHAGN & Eacute D, KRIEGER C, RASSAM M, SULLIVAN M, FRASER J, ANDR & Eacute C, PINDO M, TROGGIO M, GARDINER SE, HENRY RA, ALLAN AC, MCGHIE TK, LAING WA (2012b) QTL y mapeo de genes candidatos para composición polifenólica en fruta de manzana. Biología Vegetal BMC 12:12. [& # 160Links & # 160]

CHAGN & Eacute D, GASIC K, CROWHURST RN, HAN Y, BASSETT HC, BOWATTE DR, LAWRENCE TJ, RIKKERINK EHA, GARDINER SE, KORBAN SS (2008) Desarrollo de un conjunto de marcadores SNP presentes en genes expresados ​​de la manzana. Genómica 92: 353 y # 45358. [& # 160Links & # 160]

COLLARD B, JAHUFER M, BROUWER J, PANG E (2005) Una introducción al mapeo de marcadores Quantitative Trait Loci (QTL) y selección asistida por marcadores para la mejora de cultivos: los conceptos básicos. Euphytica 142: 169 y 45196. [& # 160Links & # 160]

COSTA F, CAPPELLIN L, FARNETI B, TADIELLO A, ROMANO A, SOUKOULIS C, SANSAVINI S, VELASCO R, BIASIOLI F (2014) Avances en el mapeo QTL para la producción de etileno en Apple (Malus x domestica Borkh). Biología y tecnología de poscosecha 87: 126 & # 45132. [& # 160Links & # 160]

COSTA F, CAPPELLIN L, ZINI E, PATOCCHI A, KELLERHALS M, KOMJANC M, GESSLER C, BIASIOLI F (2013) Validación y estabilidad de QTL para compuestos orgánicos volátiles (COV) en Apple. Ciencia de las plantas 211: 1 y # 457. [& # 160Links & # 160]

COSTA F, PEACE CP, STELLA S, SERRA S, MUSACCHI S, BAZZANI M, SANSAVINI S, VAN DE WEG WE (2010) Dinámica de QTL para la firmeza y ablandamiento de la fruta alrededor de un gen de poligalacturonasa dependiente de etileno y n. ° 45 en Apple (Malus x domestica Borkh). Revista de botánica experimental 61: 3029 & # 453039. [& # 160Links & # 160]

COSTA F, VAN DE WEG WE, STELLA S, DONDINI L, PRATESI D, MUSACCHI S, SANSAVINI S (2008) Posición del mapa y diversidad alélica funcional de Md & # 45Exp7 un nuevo gen de expansina putativo asociado con el ablandamiento de la fruta en la manzana (Malus x domestica Borkh) y pera (Pyrus communis). Tree Genetics & amp Genomes 4: 575 & # 45586. [& # 160Links & # 160]

DAVEY M, W KENIS K, KEULEMANS J (2006) Control genético del contenido de vitamina C de la fruta. Fisiología vegetal 142: 343 & # 45351. [& # 160Links & # 160]

DEVOGHALAERE F, DOUCEN T, GUITTON B, KEELING J, PAYNE W, LING TJ, ROSS JJ, HALLETT IT, GUNASEELAN K, DAYATILAKE GA, DIAK R, BREEN KC, TUSTIN DS, COSTES E, CHAGN & Eacute D, SCHAFFER KM RJ, DAVOGHALAERE F (2012) Un enfoque genómico para comprender el papel de la auxina en la manzana. (Malus x domestica) control del tamaño de la fruta. Biología Vegetal BMC 12,7. [& # 160Links & # 160]

DI GUARDO M, TADIELLO A, FARNETI A, LORENZ G, MASUERO D, VRHOVSEK U, COSTA G, VELASCO R, COSTA F (2013) Un enfoque multidisciplinario que proporciona una nueva visión de la fisiología del tostado de la pulpa de la fruta en Apple (Malus x domestica Borkh). PLoS ONE 8 (10): e78004. [& # 160Links & # 160]

DIRLEWANGER E, CARDINER G, BOUDEHRI K, RENAUD C, MONLLOR S, ILLA E, HOWAD W, AR & UacuteS P, CROSET C, POESSEL JL, MAUCOURT M, DEBORDE C, MOIN A (2009) Detección de QTL que controlan los principales componentes de la calidad de la fruta en melocotón dentro del proyecto europeo ISAFRUIT. Acta Hort. (ISHS) 814: 533 & # 45538. [& # 160Links & # 160]

DIRLEWANGER E, COSSON P, BOUDEHRI K, RENAUD C, CAPDEVILLE G, TAUZIN Y, LAIGRET F, MOING A (2006) Desarrollo de un mapa de ligamiento genético de segunda y # 45 generación para melocotón & # 91 Prunus persica (L) Batsch & # 93 y caracterización de rasgos morfológicos que afectan a flores y frutos. Genética de árboles y genomas 3: 1 & # 4513. [& # 160Links & # 160]

DIRLEWANGER E, GRAZIANO E, JOOBEUR T, GARRIGE & # 45CALDER & Eacute F, COSSON P, HOWAD W, AR & UacuteS P (2004) Mapeo comparativo y selección asistida por marcadores en cultivos frutales de rosáceas. Actas de la Academia Nacional de Ciencias de EE. UU. 101: 9891 y # 459896. [& # 160Links & # 160]

DIRLEWANGER E, COSSON P, TAVAUD M, ARANZANA J, POIZAT C, ZANETTO A, AR & UacuteS P, LAIGRET F (2002) Desarrollo de marcadores microsatélites en melocotón & # 91 Prunus persica (L) Batsch & # 93 y su uso en análisis de diversidad genética en melocotón y cereza dulce (Prunus avium L). Genética Teórica Aplicada 105: 127 & # 45138. [& # 160Links & # 160]

DIRLEWANGER E MOING A ROTHAN C SVANELLA L PRONIER V GUYE A PLOMION C Y MONET C (1999) Mapeo de QTL que controlan la calidad de la fruta en duraznos Genética teórica aplicada 98: 18 & # 4531. [& # 160Links & # 160]

DIRLEWANGER E, PRONIER V, PARVERY C, ROTHAN C, GUYE A, MONET R (1998) Mapa de ligamiento genético del melocotón & # 91 Prunus persica (L) Batsch & # 93 usando marcadores morfológicos y moleculares. Genética Teórica Aplicada 97: 888 & # 45895. [& # 160Links & # 160]

DIRLEWANGER E, PASCAL T, ZUGER C, KERVELLA J (1996) Análisis de marcadores moleculares asociados con genes de resistencia al mildiú polvoroso en melocotón & # 91 Prunus persica (L) Batsch & # 93 x Prunus davidiana híbridos. Theor Appl Genet 93: 909 & # 45919. [& # 160Links & # 160]

DUNEMANN F, ULRICH D, BOUDICHEVSKAIA A, GRAFE C, WEBER WE (2009) Mapeo QTL de compuestos aromáticos analizados por cromatografía de gases de microextracción de fase sólida y # 45 en el espacio de cabeza en la progenie de la manzana 'Discovery' x 'Prima'. Mol Breeding 23: 501 & # 45521. [& # 160Links & # 160]

DUNEMANN F, ULRICH D, MALYSHEVA & # 45OTTO L, WEBER WE, LONGHI S, VELASCO R, COSTA F (2012) Diversidad alélica funcional del gen de la acil y transferasa # 45 del alcohol de manzana MdAAT1 asociado con los contenidos volátiles de éster de fruta en cultivares de manzana. Mol Breeding 29: 609 & # 45625. [& # 160Links & # 160]

EDUARDO I, PACHECO I, CHIETERA G, BASSI S, POZZI C, VECCHIETTI A, ROSSINI L (2011) Análisis QTL de los rasgos de calidad del fruto en dos poblaciones intraespecíficas de melocotón e importancia del efecto pleiotrópico de la fecha de madurez. Tree Genetics and Genomes 7: 323 & # 45335. [& # 160Links & # 160]

EDUARDO I CHIETERA G PIRONA R PACHECO I TROGGIO M BANCHI E BASSI D ROSSINI L VECCHIETTI A POZZI C (2013) Disección genética de compuestos aromáticos volátiles del aceite esencial de melocotón: análisis QTL e identificación de genes candidatos utilizando densos mapas SNP. Tree Genetics & amp Genomes 9: 189 & # 45204. [& # 160Links & # 160]

ETIENNE C, ROTHAN C, MOING A, PLOMOION C, BODENES C, SVANELLA & # 45DUMAS L, COSSON P, PRONIER V, MONET R, DIRLEWNAGER E (2002) Genes candidatos y QTL para el contenido de azúcar y ácidos orgánicos en melocotón (Prunus persica (L) Batsch). Genética Teórica Aplicada 105: 145 & # 45159. [& # 160Links & # 160]

ILLA E, SARGENT D, GIRONA E, BUSHAKRA J, CESTARO A, CROWHURST R, PINDO M, CABRERA A, VAN DER KNAAP E, IEZZONI A, et al. (2011) Análisis comparativo de genomas rosáceos y reconstrucción de un genoma ancestral putativo para la familia. Biología evolutiva BMC 11: 9. [& # 160Links & # 160]

ILLA E, EDUARDO I, AUDERGON J, BARALE F, DIRLEWANGER E, LI X, MOING A, LAMBERT P, LE DANTEC L, GAO Z, et al. (2010) Saturación del genoma de Prunus (frutas de hueso) con genes candidatos para la calidad de la fruta. Mejora molecular 1:16. [& # 160Links & # 160]

INOUE E, MATSUKI Y, ANZAI H, EVANS K (2007) Aislamiento y caracterización de marcadores microsatélites en pera japonesa (Pyrus pirifolia Nakai). Notas de ecología molecular 7: 445 & # 45447. [& # 160Links & # 160]

IWATA H, HAYASHI T, YAMAMOTO T (2013) Evaluación potencial del genoma y estudio de asociación global # 45 y selección genómica en peras japonesas Pyrus pyrifolia. Raza Sci 63: 125 & # 45140. [& # 160Links & # 160]

KENIS K, KEULEMANS J, DAVEY MW (2008) Identificación y estabilidad de QTL para rasgos de calidad de fruta en Apple. Tree Genetics & amp Genomes 4: 647 & # 45661. [& # 160Links & # 160]

KHAN SA, CHIBON PY, DE VOS RCH, SCHIPPER BA, WALRAVEN E, BEEKWILDER J, VAN DIJK T, FINKERS R, VISSER RGF, VAN DE WEG EW, BOVY A, CESTARO A, VELASCO R, JACOBSEN E, SCHOUTEN EJ (2012 ) El análisis genético de metabolitos en frutos de manzana indica un punto caliente de mQTL para compuestos fenólicos en el grupo de ligamiento 16. Journal of Experimental Botany 63: 2895 & # 452908. [& # 160Links & # 160]

KING GJ, LYNN JR, DOVER CJ, EVANS KM, SEYMOUR GB (2001) Resolución de loci de rasgos cuantitativos para medidas mecánicas que explican la variación genética en la textura de la fruta de la manzana (Malus pumila Molino). Theor Appl Genet 1227 y # 451235. [& # 160Links & # 160]

KING GJ, MALIEPAARD C, LYNN JR, ALSTON FH, DUREL CE, EVANS KM, GRIFFON B, LAURENS F, MANGANARIS AG, SCHREVENS E, TARTARINI S, VERHAEGH J (2000) Análisis genético cuantitativo y comparación de descriptores físicos y sensoriales relacionados con firmeza de la pulpa de la fruta en la manzana (Malus pumila Molino). Theor Appl Genet 100: 1074 & # 451084. [& # 160Links & # 160]

KLAGGES C, CAMPOY JA, QUERO & # 45GARC & IacuteA J, GUZM & AacuteN A, MANSUR L, GRATACOS E, SILVA H, ROSYARA UR, IEZZONI A, MEISEL L, DIRLEWANGER E (2013) Construcción y análisis comparativo de mapas de enlace altamente densos de dos Sweet Cherry Progenies intraespecíficas de cultivares comerciales. PLoS ONE 8 (1): e54743. [& # 160Links & # 160]

KRAAKMAN ATW, MART & IacuteNEZ F, MUSSIRALIEV B, V EEUWIJK FA, NIKS RE (2006) Mapeo de desequilibrio de ligamiento de resistencia morfológica y otros rasgos agronómicamente relevantes en cultivares modernos de cebada de primavera. Mol Breed 17: 41 & # 4558. [& # 160Links & # 160]

KOEPKE T, SCHAEFFER S, KRISHNAN V, JIWAN D, HARPER A, WHITING M, ORAGUZIE N, DHINGRA A (2012) Desarrollo rápido de marcadores de haplotipos y SNP basados ​​en genes y # 45 en eucariotas que no son del modelo 45 utilizando secuenciación 3'UTR. BMC Genomics 13:18. [& # 160Links & # 160]

KUMAR S, GARRICK DJ, BINK M, WHITWORTH C, CHAGN & Eacute D, VOLZ R (2013) Nuevos enfoques genómicos desentrañan la arquitectura genética de rasgos complejos en la manzana. BMC Genomics 14: 393. [& # 160Links & # 160]

LAMBERT P, DICENTA F, RUBIO M, AUDERGON J (2007) Análisis QTL de resistencia a la enfermedad de Sharka en el albaricoque (Prunus armeniaca L) Progenie F1 de 'Polonais' x 'Stark Early Orange'. Tree Genetics and Genomes 3: 299 & # 45309. [& # 160Links & # 160]

LONGHI S, HAMBLIN M, T, TRAINOTTI L, PEACE C, P, VELASCO R, COSTA F (2013) Un enfoque basado en genes candidatos valida Md & # 45PG1 como el principal responsable de un QTL que afecta la textura de la fruta en la manzana (Malus x domestica Borkh). Biología Vegetal BMC 13,37. [& # 160Links & # 160]

LONGHI S, MORETTO M, VIOLA R, VELASCO R, COSTA F (2012) Una encuesta exhaustiva de mapeo QTL analiza la fisiología compleja de la textura de la fruta en la manzana (Malus x domestica Borkh). Journal of Experimental Botany 63: 1107 & # 451121. [& # 160Links & # 160]

MELLIDOU I, CHAGN & Eacute D, LAING WA, KEULEMANS J, DAVEY MW (2012) Variación alélica en los parámetros de GDP & # 45L & # 45 La galactosa La fosforilasa es un determinante importante de las concentraciones de vitamina C en la fruta de manzana. Fisiología vegetal 160: 1613 & # 451629. [& # 160Links & # 160]

MICHELETTI D, TROGGIO M, ZHARKIKH A, COSTA F, MALNOY M, VELASCO R, SALVI S (2011) Diversidad genética del género Malus e implicaciones para el mapeo de ligamiento con SNPs. Tree Genetics and Genomes 7: 857 & # 45868. [& # 160Links & # 160]

MORIMOTO T, HIRAMATSU Y, BANNO K (2013) Un QTL importante que controla la precocidad de la madurez de la fruta vinculado al rasgo de hoja roja / pulpa roja en Apple cv 'Maypole'. J Japón Soc Hort Sci 82: 97 & # 45105. [& # 160Links & # 160]

MONTANARI S, SAEED M, KNABEL M, KIM YK, TROGGIO M, MALNOY M, VELASCO R, FONTANA P, WON KH, DUREL C & # 45 PERCHEPIED L, SCHAFFER R, WIEDOW C, BUS V, BREWER L, GARDINER SE, CROWHURST RN, CHAGN & Eacute D (2013) Identificación de polimorfismos de nucleótido único (SNP) de Pyrus y evaluación para el mapeo genético en híbridos europeos de pera y Pyrus interespecíficos. PLoS ONE 8: (10), e 77022. [& # 160Links & # 160]

OGUNDIWIN E, PEACE C, NICOLET C, RASHBROOK V, GRADZIEL T, BLISS F, PARFITT D, CRISOSTO C (2008) Gen de leucoantocianidina dioxigenasa (PpLDOX): un marcador funcional potencial para el pardeamiento en almacenamiento en frío en melocotón. Tree Genetics and Genomes 4: 543 & # 45554. [& # 160Links & # 160]

PATERSON AH (1996) Elaboración de mapas genéticos En: Paterson AH (ed) Mapeo del genoma en plantas R G Landes Company San Diego California. Prensa académica Austin Texas 23 & # 4539. [& # 160Links & # 160]

POTTS S, M, KHAN M, A, HAN Y, KUSHAD M, M, KORBAN S, S (2013) Identificación de loci de rasgos cuantitativos (QTL) para los rasgos de calidad de la fruta en la manzana. Plant Mol Biol Rep DOI 10.1007 / s11105 & # 45013 & # 450634 & # 458. [& # 160Links & # 160]

QUILOT B, WU BH, KERVELLA J, GENARD M, FOULONGNE M, MOREAU K (2004) Análisis QTL de rasgos de calidad en un retrocruzamiento avanzado entre Prunus persica cultivares y la especie pariente silvestre P davidiana. Genética Teórica Aplicada 109: 884 & # 45897. [& # 160Links & # 160]

SALVI S (2007) Secuencias genómicas conservadas no codificantes asociadas con un locus de rasgo cuantitativo de floración y tiempo en el maíz. Proc Natl Acad Sci 104: 11376 & # 4511381. [& # 160Links & # 160]

SHULAEV V, SARGENT DJ, CROWHURST RN, MOCKLER TC, FOLKERTS O, DELCHER AL, JAISWAL P, MOCKAITIS K, LISTON A, MANE SP, et al. (2011) El genoma de la fresa del bosque (Fragaria vesca). Genética de la naturaleza 43: 109 & # 45116. [& # 160Links & # 160]

STOECKLI S, MODY K, GESSLER C, CHRISTEN D, DORN S (2009) Mapeo cuantitativo del locus de rasgos de la resistencia en la manzana a Cydia pomonella y Lyonetia clerkella y de dos rasgos frutales seleccionados. Ann Appl Biol 154: 377 & # 45387. [& # 160Links & # 160]

STOECKLI S, MODY K, GESSLER C, PATOCCHI A, JERMINI M, DORN S (2008) Análisis QTL para la resistencia de los áfidos y los rasgos de crecimiento en Apple. Tree Genetics and Genomes 4: 833 & # 45847. [& # 160Links & # 160]

SUN L, ZHANG Q, XU Z, YANG W, GUO Y, LU J, PAN H, CHENG T, CAI M (2013) Genoma y polimorfismos de ADN de ancho # 45 en dos cultivares de mei (Prunus mume sieb et zucc). BMC Genetics 14:98. [& # 160Links & # 160]

TANKSLEY SD (1993) Mapeo de polygenes. Annu Rev Genet 27: 205 y # 45233. [& # 160Links & # 160]

TRACY WF, WHITT SR, BUCKLER ES (2006) Mutación recurrente y evolución del genoma: ejemplo de Azucarado1 y el origen del maíz dulce. Crop Sci 46: S49 y # 45S54. [& # 160Links & # 160]

VELASCO R, ZHARKIKH A, AFFOURTIT J, DHINGRA A, CESTARO A, KALYANARAMAN A, FONTANA P, BHATNAGAR SK, TROGGIO M, PRUSS D (2010) El genoma de la manzana domesticada (Malus X domestica Borkh). Genética de la naturaleza 42: 833 & # 45839. [& # 160Links & # 160]

VERDE I, ABBOT A, SCALABRN S, JUNG S, SHU S, MARRONI F, ZHEBENTYAYEVA T, DETTORI M, GRIMWOOD J, CATTONARO F, et al. (2013) El borrador del genoma del melocotón de alta calidad (Prunus persica) identifica patrones únicos de domesticación por diversidad genética y evolución del genoma. Nature Genetics 45: 487 y # 45494. [& # 160Links & # 160]

VERDE I, BASSIL N, SCALABRIN S, GILMORE B, LAWLEY C, GASIC K, MICHELETTI D, ROSYARA U, CATTONARO F. VENDRAMIN E, et al. (2012) Desarrollo y evaluación de una matriz de SNP de 9K para melocotón mediante la detección y validación de SNP coordinada internacionalmente en el cultivo de germoplasma. PLoS ONE 7: e35668. [& # 160Links & # 160]

VERDE I, CUARTA R, CEDROLA C, DETTORI MT (2002) Análisis QTL de rasgos agronómicos en una población de melocotón BC1. Acta Horticlturae 592: 291 & # 45297. [& # 160Links & # 160]

VOGT J, SCHILLER D, ULRICH D, SCHWAB W, DUNEMANN F (2013) Identificación de genes de lipoxigenasa (LOX) supuestamente implicados en la formación del sabor de la fruta en la manzana (Malus x domestica). Genética y genomas de árboles DOI 101007 / s11295 & # 45013 & # 450653 & # 455. [& # 160Links & # 160]

WANG L, ZHAO S, GU C, ZHOU Y, ZHOU H, MA J, CHENG J, HAN Y (2013) Deep RNA & # 45Seq descubre el panorama del transcriptoma del melocotón. Biología molecular vegetal 83: 365 & # 45377. [& # 160Links & # 160]

WU J, WANG Z, SHI Z, ZHANG S, MING R, ZHU S, KHAN MA, TAO S, KORBAN SS, WANG H, et al. (2013) El genoma de la pera (Pyrus bretschneideri Rehd). Investigación del genoma 23: 396 & # 45408. [& # 160Links & # 160]

WU SB, WIRTHENSOHN M, HUNT P, GIBSON J, SEDGLEY M (2008) Análisis de fusión de alta resolución de SNP de almendra derivados de tecnologías ecológicamente racionales. Genética teórica y aplicada 118: 1 & # 4514. [& # 160Links & # 160]

XU K, WANG A, BROWN S (2012) Caracterización genética del locus Ma con pH y acidez titulable en Apple. Mejoramiento molecular 30: 899 & # 45912. [& # 160Links & # 160]

YOUNG ND (1996) Mapeo QTL y resistencia cuantitativa a enfermedades en plantas. Revisión anual Phytopathol 34: 479 & # 45501. [& # 160Links & # 160]

ZHANG G, SEBOLT A M, SOORIYAPATHIRANA S S, WANG D, BINK M, OLMSTEAD JW, LEZZONI AF (2010) Análisis QTL del tamaño de la fruta de una población F1 derivada de un cruce entre una variedad de cereza dulce domesticada y una cereza dulce del bosque silvestre. Tree Genetics & amp Genomes 6: 25 & # 4536. [& # 160Links & # 160]

ZHANG Q, CHEN W, SUN L, ZHAO F, HUANG B, WANG J, YANG W, TAO Y, YUAN Z, FAN G, XING Z, HAN C, PAN H, ZHONG X, SHI W, LIANG X, DU D , SUN F, XU Z, HAO R, LV T, LV Y, ZHENG Z, SUN M, LUO L, CAI M, GAO Y, WANG J, YIN Y, XU X, CHENG T, WANG J (2012a) El genoma de Prunus mume. Nature Communications, 3. [& # 160Links & # 160]

ZHANG Q, MA B, LI H, CHANG Y, HAN Y, LI J, WEI G, ZHAO S, KHAN MA, ZHOU Y, GU C, ZHANG X, HAN Z, KORBAN SS, LI S, HAN Y (2012b) Identificación, caracterización y utilización del genoma y repeticiones de secuencia simple de ancho para identificar un QTL para la acidez en Apple. BMC Genomics 13, 537. [& # 160Links & # 160]

ZHU C, GORE M, BUCKLER E, YU J (2008) Estado y perspectivas del mapeo de asociaciones en plantas. El genoma vegetal 1: 5 & # 4520. [& # 160Links & # 160]

ZINI E, BIASIOLI F, GASPERI F, MOTT D, APREA E, MARK TD, PATOCCHI A, GESSLER C, KOMJANC M (2005) Mapeo QTL de compuestos volátiles en manzanas maduras detectados por reacción de transferencia de protones y espectrometría de masas. Euphytica 145: 269 y # 45279. [& # 160Links & # 160]

Recibido: 19 de noviembre de 2013.
Aprobado: 9 de diciembre de 2013.

/> Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons


Materiales y métodos

Datos DGRP

Líneas de Drosophila:

Los datos fenotípicos y genotípicos proceden de la DGRP (Mackay et al. 2012 Huang et al. 2014). Se puede acceder a todos los datos a través del sitio web http://dgrp2.gnets.ncsu.edu. El DGRP consta de 205 líneas endogámicas obtenidas por 20 generaciones de apareamiento de hermanos completos de la descendencia de hembras individuales capturadas en la naturaleza recolectadas de la población de Raleigh, Carolina del Norte, que tienen secuencias genómicas completas (Mackay et al. 2012 Huang et al. 2014). Todas las moscas se criaron en condiciones de cultivo estándar (medio de harina de maíz-melaza-agar, 25 °, 60-75% de humedad relativa, ciclo de luz-oscuridad de 12 horas). El DGRP es polimórfico para inversiones comunes y Wolbachia pipientis estado de infección (Huang et al. 2014). Estos factores se incluyeron en los modelos que se describen a continuación como efectos fijos.

Fenotipos de rasgos cuantitativos:

La resistencia al hambre para 197 líneas DGRP se evaluó colocando 10 moscas del mismo sexo de 2 días en viales de cultivo que contenían medio no nutritivo (agar al 1,5% y 5 ml de agua) y puntuando la supervivencia cada 8 horas hasta que todas las moscas estuvieran muertas (Harbison et al. 2004). Había cinco viales replicados por sexo por línea (total norte = 19,361 mujeres norte = 9672 hombre norte = 9689). La recuperación del coma frío para 159 líneas de DGRP se midió transfiriendo moscas de 3 a 7 días sin anestesia a viales vacíos y colocándolos en hielo durante 3 horas. Las moscas se transfirieron a temperatura ambiente y se registró el tiempo que tardó cada individuo en enderezarse y pararse sobre sus patas (Morgan y Mackay 2006).Hubo dos réplicas de 50 moscas por sexo por línea (total norte = 32,231 mujeres norte = 16,170 hombres norte = 16.061). La respuesta de sobresalto para 166 líneas DGRP se midió colocando moscas adultas individuales de 3 a 7 días, recolectadas bajo CO2 exposición, en viales que contienen 5 ml de medio de cultivo y dejarlos durante la noche para que se aclimaten a su nuevo entorno. Al día siguiente, entre las 8 a. M. Y las 12 p. M. (2 a 6 horas después de que se encendieran las luces), cada mosca fue sometida a una perturbación mecánica con un toque suave, y la cantidad total de tiempo que la mosca estuvo activa en los 45 segundos inmediatamente siguientes se registró la perturbación (Mackay 2001). Hubo dos réplicas de 20 moscas por sexo por línea (total norte = 13,276 mujeres norte = 6674 hombre norte = 6602).

Genotipos:

Los genotipos se obtuvieron a partir de secuencias de genoma completo, utilizando un procedimiento de genotipado integrativo (Huang et al. 2014). Todos los análisis se basaron en la segregación de SNP bialélicos con frecuencias de alelos menores ≥0.05 y para los cuales la calidad de la variante en escala Phred fue & gt500 y la tasa de llamada de genotipo fue ≥0.8, para un total de 1.725.755 SNP distribuidos en cinco brazos de cromosomas (2L, 2R, 3L, 3R, y X).

Características genómicas:

Los genes agrupados de acuerdo con un término de Ontología Genética (GO) específico se consideraron una característica genómica. Los genes se vincularon a los términos "procesos biológicos" (BP), "función molecular" (MF) y "componente celular" (CC) GO (Gene Ontology Consortium et al. 2000), utilizando el paquete BioConductor “org.Dm.eg.db” v. 2.14 (Carlson 2013). En los análisis solo se utilizaron términos GO con al menos 10 genes directamente evidenciados. Los SNP se asignaron a genes FlyBase utilizando las anotaciones v5.49 de la D. melanogaster genoma de referencia (Tweedie et al. 2009 Mackay et al. 2012 Huang et al. 2014). Solo los 963,235 SNP ubicados dentro de los genes (es decir., dentro de marcos de lectura abiertos) se utilizaron para la característica genómica. En total, los marcadores se asociaron con 10517 genes y 1145 términos GO. Se utilizó un total de 1.725.755 marcadores en todos los análisis, y el número de marcadores vinculados a un solo término de GO osciló entre 23 y 163.938.

Análisis estadísticos utilizando modelos lineales mixtos

Los análisis se realizaron utilizando dos modelos mixtos lineales diferentes: un modelo GBLUP estándar y un modelo GFBLUP utilizando información previa sobre características genómicas. A continuación, presentamos detalles de los modelos y procedimientos estadísticos utilizados para comparar los modelos.

Modelos genómicos:

Para cada característica genómica (es decir., Término GO) se realizó un análisis por separado. En cada uno de los análisis de GFBLUP evaluamos una característica genómica única basada en un modelo lineal mixto que incluye dos efectos genómicos aleatorios, donde es el vector de observaciones fenotípicas ajustadas (o fenotipos simulados), es el vector de una media general, es la matriz de diseño vincular las observaciones a los valores genómicos (F y r), es una matriz de diseño para replicar los efectos dentro de la línea (l), es el vector de valores genómicos específicos de línea capturados por marcadores genéticos vinculados a la característica genómica de interés, es el vector de valores genómicos específicos de línea no capturado por marcadores genéticos vinculados a la característica genómica, y es el vector de residuos. Se asumió que los efectos genómicos aleatorios y los residuos eran valores independientes distribuidos normalmente descritos a continuación: y

GBLUP se basó en un modelo lineal mixto que incluía solo un efecto genómico aleatorio, con la misma notación anterior, excepto que es el vector de valores genómicos capturados por todos los marcadores genéticos. Se asumió que los valores genómicos aleatorios y los residuos eran valores independientes distribuidos normalmente descritos a continuación: y

En los análisis de los datos simulados, el término para los efectos repetidos dentro de la línea se excluyó en ambos análisis del modelo genómico.

La matriz de relación genómica aditiva (VanRaden 2008) se construyó utilizando todos los marcadores genéticos de la siguiente manera: donde es la matriz del genotipo centrada y escalada, y es el número total de marcadores. Cada vector de columna de W se calculó de la siguiente manera: donde es la frecuencia del alelo menor del Ith marcador genético y es el Ivector de columna de la matriz de conteo de alelos, METRO, que contiene los genotipos codificados como 0 o 2 dependiendo del número de alelos menores. La matriz de relación genómica aditiva para la característica genómica se construyó de manera similar, utilizando solo el conjunto de marcadores genéticos definido por la característica genómica.

Fenotipos ajustados utilizados en análisis de modelos genómicos:

Los fenotipos utilizados en los análisis del modelo GBLUP y GFBLUP se derivaron de registros fenotípicos de los rasgos cuantitativos ajustados por factores relevantes, utilizando el modelo lineal mixto donde es el vector de observaciones fenotípicas, es la matriz de diseño, es el vector de efectos fijos de inversión cariotipos y Wolbachia estado de infección, es la matriz de diseño que vincula las observaciones con los valores genómicos, es una matriz de diseño para los efectos replicados dentro de la línea, es el vector de los valores genómicos capturados por todos los marcadores genéticos, es el vector de los efectos replicados dentro de la línea y es el vector de residuos. Se asumió que los efectos aleatorios (y) y los residuos eran valores independientes distribuidos normalmente que se describen a continuación: y Los fenotipos ajustados utilizados como variables de respuesta para el análisis del modelo genómico que se describen a continuación se calcularon como

Estimación de los componentes de la varianza:

Las estimaciones de los componentes de la varianza () definidos en los modelos descritos anteriormente se obtuvieron utilizando un procedimiento de máxima verosimilitud restringida (REML) de información promedio (Madsen et al. 1994 Johnson y Thompson 1995) como se implementó en el software DMU (Madsen et al. 1994). En este procedimiento, usamos una inversa generalizada de las matrices de relaciones genómicas. Esto fue necesario porque estas matrices no tenían rango completo debido al centrado, así como en los casos en que el número de marcadores genéticos era menor que el número de líneas.

Comparaciones de modelos:

Los modelos se evaluaron y compararon en función del ajuste del modelo, la capacidad de predicción del modelo y la precisión de los parámetros genómicos estimados.

Parámetros genómicos:

Los parámetros genómicos se derivaron de las estimaciones de los componentes de la varianza. Las inferencias sobre la heredabilidad genómica se basaron en las siguientes proporciones: para GBLUP y para GFBLUP. La inferencia sobre la partición de la varianza genómica en GFBLUP se basó en las siguientes proporciones: y Estas proporciones cuantifican la proporción de la varianza genómica total capturada y no capturada por los marcadores genéticos en la característica genómica.

Ajuste del modelo:

El ajuste del modelo se evaluó utilizando una razón de verosimilitud (LR) aquí definida como dónde está la probabilidad del modelo ajustado. La teoría estándar muestra que el estadístico de la prueba LR se distribuye asintóticamente, ya que donde los grados de libertad son la diferencia en el número de parámetros entre los dos modelos. los PAG-Los valores calculados para evaluar la significancia de la prueba de razón de verosimilitud se basaron en una -distribución con 1 d.f. Sin embargo, se ha demostrado previamente que si el valor de la hipótesis nula está en el límite del espacio de parámetros (p.ej.,), la distribución asintótica de las estadísticas de prueba LR puede aproximarse mediante una mezcla 50:50 de distribuciones-con 0 y 1 d.f. (Self y Liang 1987). Alternativamente, es posible derivar una distribución empírica del estadístico de prueba LR como hemos mostrado anteriormente (Edwards et al. 2015).

Capacidad predictiva del modelo:

La capacidad de los modelos para predecir el valor genómico total se evaluó mediante un procedimiento de validación cruzada. En el modelo GFBLUP el valor genómico total es = + y en GBLUP es = En el procedimiento de validación cruzada, estimamos los parámetros genómicos usando los fenotipos de las líneas en los datos de entrenamiento (90% de las líneas) y predijeron el total genómico valor de las líneas en los datos de validación (10% de las líneas). BLUP se utiliza para predecir los valores genómicos totales en los modelos GFBLUP y GBLUP como se describe a continuación. Luego calculamos una correlación entre los valores genómicos totales predichos con o sin los fenotipos observados establecidos como faltantes. Para los datos simulados y para los datos DGRP observados, definimos 50 subconjuntos de datos de entrenamiento cruzado (validación) y los aplicamos a cada característica genómica. Para cada característica genómica, la capacidad predictiva se definió como la correlación promedio de las 50 validaciones cruzadas. Se aplicó un procedimiento similar al modelo GBLUP que sirve de referencia. Para cada característica genómica de Welch t-prueba (es decir., varianza desigual t-prueba) se utilizó para probar la diferencia en la capacidad predictiva media de los dos modelos (Welch 1947). Para cada rasgo se probaron 1145 términos GO. Por lo tanto PAG-valores de Welch t-prueba se ajustaron para pruebas múltiples controlando la tasa de descubrimiento falso como se implementó en R (Benjamini y Hochberg 1995 R Core Team 2015).

Predicción del valor genómico total usando BLUP:

El valor genómico total de las líneas en los datos de validación se predijo en función de los fenotipos observados para las líneas en los datos de entrenamiento. En el modelo GFBLUP, la expectativa condicional de los valores genómicos totales para las líneas en los datos de validación dados los fenotipos observados para las líneas en los datos de entrenamiento () se puede escribir como donde la matriz de relaciones genómicas para la característica genómica está dividida de acuerdo con las relaciones. entre las líneas de los datos de entrenamiento (), entre las líneas de los datos de validación () y entre las líneas de los datos de entrenamiento y validación (). Se aplica una partición similar a GRAMOr y I en el modelo GFBLUP. En aras de la simplicidad, hemos ignorado la matriz de diseño. Z y los efectos replicados dentro de la línea en la expresión de la expectativa condicional. Por lo tanto, el valor genómico total se predice utilizando los componentes de varianza estimados (y) en los datos de entrenamiento. El término más a la derecha, constituye los fenotipos corregidos para efectos fijos para las líneas en los datos de entrenamiento. El término inverso es esencialmente la estructura de varianza-covarianza para los fenotipos corregidos. Estos dos términos juntos son los fenotipos estandarizados y corregidos para los individuos en los datos de entrenamiento, que se proyectan en la estructura de covarianza genética total entre el entrenamiento y los datos de validación.

En el modelo GBLUP, una expresión similar para la expectativa condicional del valor genómico total para las líneas en los datos de validación dados los fenotipos observados para las líneas en los datos de entrenamiento se puede escribir como

Implementación:

Los enfoques de modelado GFBLUP y GBLUP se implementan en el paquete R qgg, que está disponible en http://psoerensen.github.io/qgg/. Esto incluye ajustar una serie de modelos lineales mixtos, estimar los componentes de la varianza usando REML, predicción usando BLUP y procedimientos de validación cruzada. Se proporcionan ejemplos de scripts y conjuntos de datos para ilustrar los enfoques de modelado GFBLUP y GBLUP. Para un diseño experimental específico con fenotipos replicados dentro de la línea, como DGRP, es más eficiente usar el procedimiento REML de información promedio (Madsen et al. 1994 Johnson y Thompson 1995) implementado en DMU (Madsen et al. 1994). La función aireml en el paquete qgg proporciona una interfaz R a la DMU que se puede descargar desde http://dmu.agrsci.dk/DMU/.

Datos simulados

Establecimos una serie de estudios de simulación para investigar los factores que influyen en el poder para detectar características genómicas que afectan el fenotipo del rasgo, la estimación de los parámetros genómicos y la capacidad de predicción de los dos modelos mixtos lineales probados. Los factores que variaron en las simulaciones incluyeron heredabilidad genómica (), proporción de varianza genómica explicada por SNP causales en el rasgo genómico (), proporción de SNP no causales en el conjunto de marcadores genéticos definido por el rasgo genómico (dilución), distribución del genoma de los SNP causales (modelo causal) (es decir., cómo se distribuyeron físicamente los SNP causales en el genoma: aleatorios o agrupados) y el número de réplicas (es decir., el número de registros fenotípicos para cada línea) dentro de las líneas (nortereps).

Genotipos:

Las simulaciones se basaron en el conjunto de datos de genotipo DGRP real de 205 líneas y 1.725.755 SNP. En todos los escenarios, hubo 1000 SNP causales. Los conjuntos causales se dividieron en dos subconjuntos. El primer subconjunto incluyó 100 SNP y se utilizó como el conjunto de SNP causal en la característica genómica que explica el 10%, 20%, 30% o 50% de la varianza genómica total. El segundo subconjunto incluyó 900 SNP y explicó la variación genómica restante. Para imitar escenarios genéticos relevantes, se simuló la distribución del genoma de los SNP causales en la característica genómica utilizando dos modelos causales diferentes: a aleatorio y un grupo modelo. El modelo de agrupamiento simula la situación en la que ocurren múltiples SNP causales en un número limitado de genes, mientras que en el modelo aleatorio los SNP causales únicos ocurren en un número mayor de genes. La principal diferencia es que la varianza genómica está asociada con una región del genoma más pequeña en el modelo de agrupamiento en comparación con el modelo aleatorio. Para el modelo causal agrupado, los 100 SNP causales en se eligieron de 20 regiones del genoma seleccionadas al azar que abarcan 50 SNP cada una, y los 900 SNP restantes se seleccionaron al azar del conjunto completo de SNP (excluyendo los SNP en). Para el modelo causal aleatorio, los SNP en y se seleccionaron al azar del conjunto completo de SNP. Para investigar los efectos de los SNP no causales dentro de los conjuntos causales, agregamos un número creciente de SNP no causales (200, 400, 800,…, 2000) a los conjuntos causales, en un proceso denominado dilución. Los SNP no causales se seleccionaron al azar en el genoma o mediante muestreo de SNP ubicados directamente arriba y abajo del SNP causal (denominados SNP locales).

Fenotipos:

Los fenotipos se simularon utilizando el siguiente modelo lineal: y = gramo1 + gramo2 + mi, dónde gramo1norte(0,GRAMO1* ), gramo2norte(0,GRAMO2* ), y minorte(0,I* ). GRAMO1 y GRAMO2 son las matrices de relaciones genómicas para los SNP causales en C1 y C2, respectivamente. La varianza fenotípica total fue de 100 en todos los escenarios. Simulamos datos bajo heredabilidades genómicas aditivas de 0.1, 0.3 y 0.5, para analizar escenarios con heredabilidades bajas a intermedias, reflejando las observadas en los datos reales. Para analizar escenarios con efectos SNP no uniformes, la proporción de varianza genómica aditiva explicada por los SNP causales en se varió entre escenarios: 0.1, 0.2, 0.3 y 0.5. Estos parámetros fueron investigados para nortereps de 5, 10 y 50. Aumentar el número de repeticiones por línea disminuye la varianza del valor fenotípico de cada línea.

La combinación de estos factores arrojó un total de 1440 conjuntos de datos simulados individuales [3 (nortereps) × 3 (h 2) × 4 () × 2 (modelo causal) × 20 (dilución)], cada uno de los cuales se replicó 50 veces. Para cada conjunto de datos y réplica, estimamos los componentes de la varianza para los modelos GBLUP y GFBLUP, utilizando REML. El ajuste del modelo se evaluó mediante la prueba de razón de verosimilitud y la capacidad predictiva del modelo mediante el procedimiento de validación cruzada descrito anteriormente. Las estadísticas LR, potencia y capacidad predictiva se calcularon y se resumen en Resultados.

Poder de detección:

La potencia se calculó para cada uno de los escenarios simulados definidos en detalle anteriormente. los PAG-Los valores utilizados para determinar la potencia de la prueba de razón de verosimilitud se calcularon con base en la distribución teórica con 1 d.f. Para cada uno de los escenarios simulados, la potencia se calculó como la fracción (de 50 réplicas) de los análisis que condujeron a un ajuste del modelo significativamente mejor utilizando el modelo GFBLUP en comparación con el modelo GBLUP (es decir., el observado PAG-valor era & lt0.05).

Disponibilidad de datos

Se puede acceder a los datos DGRP a través del sitio web en http://dgrp2.gnets.ncsu.edu.


Mejoramiento asistido por genómica para la mejora de rasgos

El mejoramiento asistido por genómica (GAB) se inicia con la identificación de marcadores genómicos asociados con QTL o genes relacionados con el rasgo agronómico de interés y luego su aplicación en la plataforma de mejoramiento (Fig. 2). Los marcadores moleculares ayudan en una variedad de descendientes deseados en el ciclo de reproducción en la etapa de crecimiento temprano utilizando plataformas de genotipado de alto rendimiento basadas en NGS (Singh et al.2017 Crossa et al.2017). Se han implementado numerosas estrategias de GAB para la mejora de cultivos, incluido el retrocruzamiento asistido por marcadores, la selección recurrente asistida por marcadores y la selección genómica. Recientemente, se agregó a la lista la cría rápida para acelerar los procesos de cría. Países como India dependen principalmente del mejoramiento genético para la mejora de cultivos y la liberación de variedades. En tales casos, se requiere fortalecer las estrategias de mejoramiento y modernizar los enfoques para enfrentar los desafíos que enfrenta la agricultura, a tiempo.


Ver el vídeo: Uso de marcadores moleculares PCR para estudios de diversidad de plantas y animales (Junio 2022).