Información

¿Marcador de selección de un vector citoplasmático que funciona a niveles de expresión bajos?

¿Marcador de selección de un vector citoplasmático que funciona a niveles de expresión bajos?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Necesito expresar un marcador de selección en un plásmido en células humanas (por ejemplo, HEK293). Sin embargo, estoy usando un vector citoplasmático derivado de un virus no humano con su propio mecanismo para el inicio de la transcripción. Esto significa que el nivel de expresión de cualquier marcador proteico chupar: número de copias bajo, promotor muy débil, transcripciones inestables: estas son cosas que no puedo cambiar en este contexto biológico preciso.

La mayoría de los marcadores de selección (por ejemplo KanMX) vienen con su propio promotor de caja negra, por lo que no sé si se basan en la producción de una gran cantidad de proteínas.

¿Cuál sería un marcador que podría seleccionarse con mayor probabilidad a pesar de tener un nivel de expresión muy bajo? No pude encontrar ningún recurso comparando los números de copias de proteínas de los marcadores clásicos.

Necesito estar seguro de que las células que no pueden sobrevivir a la presión selectiva murieron porque no tenían el marcador, y no porque el marcador se expresó demasiado débilmente para proteger las células que tienen el marcador. El enfoque estándar sería utilizar una selección regular de antibióticos y simplemente trabajar con concentraciones más bajas de antibióticos, pero la cantidad de falsos positivos probablemente sería demasiado alta.

Puedo manipular la célula huésped hasta cierto punto, por lo que puedo usar la selección de antibióticos, pero también puedo complementar una deleción condicional de un gen esencial (marcador auxotrófico o genes no metabólicos).


Citometría de flujo en busca de su plásmido.

Estas personas etiquetaron su plásmido con un marcador fluorescente patentado, luego usaron citometría de flujo para detectar células que habían absorbido el plásmido.

Un nuevo método de citometría de flujo rápido y reproducible para optimizar la eficiencia de la transfección en las células.

Un método alternativo y más directo al uso de genes indicadores fluorescentes es etiquetar directamente los ácidos nucleicos con tintes fluorescentes para rastrear su entrega intracelular [16] ... Con los kits no enzimáticos Label IT® Tracker TM, cualquier plásmido se puede etiquetar de manera personalizada en un simple reacción química de un solo paso antes de la introducción en células de mamíferos [18]. Por lo tanto, tanto la localización subcelular del ADN marcado como el transgén informador de expresión se pueden controlar simultáneamente después de la introducción del plásmido marcado en células de mamíferos [16, 18] ...

En este documento, demostramos el desarrollo de un ensayo de citometría de flujo para determinar la eficiencia de la transfección mediante el etiquetado de un plásmido indicador con Label IT® TrackerTM. Este método no depende de la cotransfección de dos plásmidos diferentes y cuantifica simultáneamente la muerte celular, la captación del plásmido marcado durante la transfección transitoria y la expresión de la proteína diana.

Incluso si solo una pequeña fracción de sus células absorben su plásmido brillante, las separará del resto con flujo.


Vector de expresión

Un vector de expresión, también conocido como construcción de expresión, suele ser un plásmido o virus diseñado para la expresión génica en las células. El vector se utiliza para introducir un gen específico en una célula diana y puede controlar el mecanismo de síntesis de proteínas de la célula para producir la proteína codificada por el gen. Los vectores de expresión son las herramientas básicas en biotecnología para la producción de proteínas.

El vector está diseñado para contener secuencias reguladoras que actúan como regiones potenciadoras y promotoras y conducen a una transcripción eficiente del gen transportado en el vector de expresión. [1] El objetivo de un vector de expresión bien diseñado es la producción eficiente de proteínas, y esto puede lograrse mediante la producción de una cantidad significativa de ARN mensajero estable, que luego puede traducirse en proteína. La expresión de una proteína puede controlarse estrictamente y la proteína solo se produce en una cantidad significativa cuando es necesario mediante el uso de un inductor; en algunos sistemas, sin embargo, la proteína puede expresarse de manera constitutiva. Escherichia coli se usa comúnmente como hospedador para la producción de proteínas, pero también se pueden usar otros tipos de células. Un ejemplo del uso de un vector de expresión es la producción de insulina, que se usa para tratamientos médicos de la diabetes.


Fondo

El cáncer de mama (CM), el tumor maligno que se diagnostica con más frecuencia en las mujeres, es también la causa más frecuente de muerte por cáncer en todo el mundo [1] y un importante problema de salud pública mundial. La BC es muy heterogénea en sus características patológicas, lo que planteó un tremendo desafío para la selección del tratamiento [2]. Hasta ahora, se han reconocido bien pocos biomarcadores en los carcinomas de mama invasivos, incluidos el receptor de estrógeno (RE) y el receptor de progesterona (PR), que se asocian con un mejor resultado y son predictivos de la sensibilidad endocrina. La sobreexpresión del receptor 2 del factor de crecimiento epidérmico humano (HER2) está relacionada con una disminución de la supervivencia libre de recaídas (SLR) y la supervivencia general (SG) [3, 4]. Los agentes que se dirigen a ER y HER2, como el tamoxifeno y el trastuzumab, han tenido mucho éxito como terapias de BC. Sin embargo, en los tumores surgieron mecanismos multifacéticos que causaron resistencia al tratamiento endocrino en terapias únicas o combinadas [5]. Por lo tanto, la identificación completa de más biomarcadores y dianas moleculares es esencial para una gestión clínica óptima y personalizada del cáncer de mama.

Los receptores activados por proliferadores de peroxisomas (PPAR) pertenecen a la superfamilia de receptores nucleares (NR) [6] y funcionan como factores de transcripción activados por ligandos [7]. Después de la activación por ligandos (p. Ej., 15d-PGJ2 o el ligando sintético tiazolidindiona), los PPAR se heterodimerizan con el receptor de retinoides X (RXR) e interactúan con los elementos de respuesta del receptor activado por el proliferador (PPRE) presentes en los promotores de genes diana [8]. Aunque la superfamilia NR se definió debido a las acciones genómicas de los receptores que requieren localización nuclear, se ha sugerido que los PPAR se localizan primero en el citoplasma con funciones asociadas específicas [9].

Entre las tres isoformas de PPAR (α, β / δ y γ), PPARγ juega un papel crucial en la adipogénesis y el metabolismo de los lípidos [10] y también se encuentra expresado en muchos cánceres humanos, incluido el BC [11]. PPARγ influye en los procesos inflamatorios, proliferación celular, diferenciación, apoptosis y angiogénesis tumoral [10, 12]. Se ha informado de un efecto promotor de tumores de PPARγ en algunos tumores, como el de hígado [13], cáncer [14] o cáncer de colon [15]. Además, la mayoría de los estudios anteriores han revelado que PPARγ actúa como un supresor de tumores en BC, inhibiendo la proliferación celular e induciendo la apoptosis en diferentes modelos in vivo e in vitro [16, 17, 18]. Además, se ha sugerido que PPARγ participa en la resistencia a la quimioterapia de los TNBC [19].

Curiosamente, algunos de los ligandos PPARγ, prostaglandinas (PG) se producen a partir de la conversión del ácido araquidónico por las ciclooxigenasas Cox-1 y Cox-2. La Cox-1 se expresa constitutivamente en muchas células normales, mientras que la Cox-2 generalmente se considera inducida por citocinas inflamatorias y factores de crecimiento, desempeñando un papel importante en la carcinogénesis [20, 21]. Los estudios de importancia de Cox en la progresión e invasión tumoral se centraron principalmente en la influencia de Cox-2 [22]. Sin embargo, se demostró que la Cox-1 está altamente expresada y juega un papel fundamental en algunos carcinomas, como los cánceres de ovario [23] y de mama [24]. Más recientemente, se ha demostrado que los niveles de ARNm y proteína de Cox-1 son más altos en los tumores de mama malignos que en los tejidos normales, mientras que el nivel de ARNm de Cox-2 es más bajo en los tumores malignos. No obstante, la inmunotinción de Cox-2 estromal y glandular mostró niveles más altos en los tumores de mama malignos [25].

Por tanto, parece obvio que se necesita más atención para analizar la relevancia de la expresión combinada de PPARγ y Cox (especialmente Cox-1) en BC. En el presente estudio, hemos analizado la expresión de PPARγ y de las dos proteínas de Cox en 308 muestras primarias de BC en relación con la supervivencia, para determinar si una podría, independientemente o en relación con las otras, estar relacionada con la progresión de BC.


Estrategias de construcción para desarrollar vectores de expresión para la producción de anticuerpos monoclonales recombinantes en células CHO

En los últimos años se ha visto el uso de proteínas recombinantes en el tratamiento de diferentes enfermedades. Entre ellos, los anticuerpos monoclonales (mAb) son actualmente la clase de proteínas recombinantes bioterapéuticas de más rápido crecimiento. Las células de ovario de hámster chino (CHO) son las células huésped más comúnmente utilizadas para la producción de estos mAb recombinantes. Los vectores de expresión determinan el nivel de expresión y la calidad de los mAb recombinantes. Actualmente, se han desarrollado pocas estrategias de construcción para vectores de expresión de mAbs recombinantes en células CHO, incluido el vector monocistrónico, el vector de expresión de múltiples promotores y el vector tricistrónico mediado por el sitio de entrada del ribosoma interno (IRES) o el elemento Furin-2A. Entre ellos, el vector mediado por Furin-2A es un enfoque eficaz debido a las ventajas de una alta eficiencia de "autoescisión" y una expresión igual de cadenas ligeras y pesadas a partir de un único marco de lectura abierto. Aquí, hemos revisado el progreso en el desarrollo de diferentes estrategias para construir vectores de expresión de mAb recombinantes en células CHO y sus posibles ventajas y desventajas.


Resultados

La sobreexpresión de MAP17 en células tumorales cervicales humanas Hela altera los niveles de expresión de ARN de los genes que regulan las ROS

Para explorar primero si las células cervicales alteran la regulación de ROS al expresar MAP17, expresamos ectópicamente ADNc de MAP17 en células tumorales cervicales Hela (Figuras 1A y 1B). Después de la selección, analizamos la transcripción de 84 genes que regulan ROS (RT 2 Profiler & # x02122 PCR Array de Sabioscience). Encontramos que en aproximadamente el 30% de los genes, los niveles de ARN variaban más de 4 veces (Figura 1C). Algunos genes, como PTGS1 (aumento de 39 veces) o SIRT2 (aumento de 10 veces), estaban claramente regulados al alza, mientras que BNIP3 o MSRA (disminución de 18 veces) estaban regulados a la baja (Tabla 1). Estos datos indican claramente que la sobreexpresión de MAP17 en las células Hela alteró los niveles de ARN de los genes que regulan el estrés oxidativo, y esto alteró los niveles de ROS producidos en las células Hela (Figura S1). A continuación, buscamos determinar si MAP17 también alteraba la respuesta a fármacos quimioterapéuticos que se sabe que activan el estrés oxidativo. Las células Hela que llevan ADNc de MAP17 o un vector vacío se sometieron a ensayos citotóxicos estándar [26], [27] con 11 concentraciones diferentes de cisplatino, oxaliplatino o gemcitabina. Encontramos que las células con MAP17 eran más sensibles (más del doble) que las células de control (Figura 1D y Figura S2). Por lo tanto, nuestros datos indican que MAP17 alteró el equilibrio transcripcional de genes involucrados en el metabolismo de ROS en células tumorales de cuello uterino, y este desequilibrio puede aumentar la sensibilidad celular a fármacos quimioterapéuticos que inducen ROS.

Las células cancerosas Hela que expresan ADNc de MAP17 ectópico se seleccionaron y analizaron para determinar la expresión de la proteína MAP17 mediante A) medición cuantitativa del ARNm de MAP17 expresado ectópicamente en células Hela y B) inmunodetección después de centrifugación con citospina en portaobjetos. C) Map17 altera la transcripción de genes implicados en el estrés oxidativo. Se muestra un gráfico que representa la distribución de alteraciones transcripcionales de genes inducidas por MAP17 en células Hela. D) Los valores de IC50 se muestran para diferentes fármacos quimioterapéuticos en células Hela que expresan MAP17 o solo con vector.

Tabla 1

Genes regulados positivamente & # x0003e4 vecesGenes regulados a la baja & # x0003e4 veces
Símbolo genDoblar el cambioSímbolo genDoblar el cambio
CCL57,3958ALBA& # x022124,3486
GPX36,9993ATOX1& # x022127,0806
KRT15,5198BNIP3& # x0221218,7871
MGST35,1573GATO& # x022126,293
PRDX28,0437DHCR24& # x022125,3102
PRDX54,054DUOX1& # x022125,2595
PRG37,0221GPX1& # x022124,3298
PTGS139,1571MSRA& # x0221218,4663
PXDNL5,2399NCF2& # x022127,5352
SCARA34,9336OXR1& # x022124,2456
SIRT29,8365OXSR1& # x022125,6898
SOD24,1722PRDX3& # x022128,1426
SOD35,5476PRDX4& # x0221213,334
SRXN14,9745SELS& # x022124,7526
TXNRD14,4648STK25& # x022125,165
TXNRD25,0278HPRT1& # x0221214,7514

La sobreexpresión de MAP17 en tumores de cuello uterino humano se correlaciona con la enfermedad en estadio avanzado

MAP17 se sobreexpresa en carcinomas, específicamente en carcinomas de ovario, próstata y mama, y ​​su sobreexpresión se correlaciona con estadios avanzados [6]. Por lo tanto, queríamos confirmar si la expresión de MAP17 es un marcador de la tumorigénesis cervical humana. Para evaluar la expresión de la proteína MAP17 en estos tumores, analizamos 239 muestras de tumores de cuello uterino mediante inmunohistoquímica. En todos los casos, la muestra se obtuvo a partir de una biopsia previa al tratamiento, y en todos los casos el tratamiento fue homogéneo (tabla 2), consistente en radio más braquiterapia combinada con 6 ciclos de cisplatino. La mayoría de los tumores estaban en estadios TNM IB, IIA y IIB, sin embargo, había varios tipos de tumores representados. Los diferentes tumores incluyeron 97 carcinomas escamosos, 32 carcinomas mucinosos, 12 carcinomas endometroides, 10 carcinomas de células claras, 8 de tipo seroso, 7 de tipo transicional, 9 indiferenciados, 7 carcinomas adenoescamosos y 3 adenomas. Además, la cohorte contenía 54 tumores de un tipo no identificado.

Tabla 2

Sexo Femenino 100%
La edad 26 & # x0201397Promedio 55,67
Calificación113,6%(n & # x0200a = & # x0200a36)
236,3%(n & # x0200a = & # x0200a96)
332,2%(n & # x0200a = & # x0200a85)
Dakota del Norte17,8%(n & # x0200a = & # x0200a47)
EscenarioI A1%
IB60%
IIA20%
IIB18%
III1%
TratamientoRadioterapia (50 Gy) + braquiterapia (15 Gy) + cisplatino (6 ciclos: 40 mg / m2)

El análisis de los niveles de MAP17 en el conjunto de tumores mostró que solo el 18% de todos los tumores fueron negativos para la tinción de MAP17, mientras que el 82% restante fueron positivos en diferentes grados. La Figura 2A muestra imágenes representativas de la tinción MAP17 de algunos tipos de tumores cervicales.

A) Se muestran imágenes representativas de inmunotinción de MAP17 para diferentes tipos de tumores. B) Se muestra un gráfico que representa el porcentaje de tumores de cuello uterino con diferentes niveles de MAP17. C) Se realizó la inmunotinción que muestra la distribución de MAP17 solo en la membrana. D) Se muestra la distribución de los niveles de expresión de MAP17 entre diferentes tipos de tumores cervicales. El gráfico de niveles máximos se refiere a la máxima intensidad de tinción observada en cualquier parte del tumor (escala de 0 a 3). El gráfico de niveles normalizados (puntuación) se refiere a los niveles máximos (0 & # x020133) puntuados por el porcentaje de celdas (0 & # x02013100). Los niveles normalizados se obtuvieron multiplicando el porcentaje de células por el nivel de intensidad observado. E) Se muestra un gráfico que representa el porcentaje de tumores positivos para MAP17 por subtipo de tumor.

Los resultados de la tinción se evaluaron a nivel microscópico de acuerdo con criterios visuales y se designaron de la siguiente manera: 0 & # x0200a = & # x0200ano tinción 0,5 & # x0200a = & # x0200 tinción muy débil 1 & # x0200a = & # x0200 tinción positiva, clara pero tinción débil 1,5 & # x0200a = & # x0200a positiva 2 & # x0200a = & # x0200a positiva, tinción fuerte y 3 & # x0200a = & # x0200a positiva, tinción muy fuerte. También anotamos el porcentaje de células tumorales positivas para MAP17 para puntuar los niveles generales de MAP17 observados. De los 239 tumores, solo 43 (18%) no expresaban MAP17. Un total de 146 (61%) mostraron niveles intermedios y 50 tumores (21%) mostraron niveles de expresión de MAP17 muy altos (Figura 2B).

Observamos dos distribuciones subcelulares diferentes de MAP17. El primer patrón de distribución involucró tinción citoplasmática y membranosa, con amplia distribución citoplásmica, especialmente en la región perinuclear (Figura 2A). El segundo patrón de distribución mostró tinción de MAP17 solo en la membrana (Figura 2C). La mayoría de los tumores positivos para MAP17 mostraron una distribución citoplásmica más membranal; sin embargo, aproximadamente el 5% de las muestras mostraron una clara distribución solo de membrana. Sorprendentemente, algunos tumores contenían diferentes poblaciones que mostraban ambas localizaciones subcelulares para MAP17; actualmente no conocemos la razón de tales distribuciones diferenciales. En células cultivadas, MAP17 muestra principalmente tinción citoplásmica perinuclear con algo de localización en la membrana plasmática. Es posible que el fuerte anclaje de MAP17 a compartimentos membranosos intracelulares, como el Golgi, explique esta localización intracelular. Por tanto, también es posible que algunos tumores acumulen compartimentos membranosos intracelulares y acumulen niveles elevados de MAP17 en el citosol, mientras que en otros tumores el nivel de membranas internas es mínimo y las células acumulan MAP17 en la membrana celular. También puede depender del contexto molecular del tumor específico o clon celular. Sin embargo, se requiere más investigación para comprender esta variabilidad de distribución.

A continuación, analizamos los niveles de distribución de MAP17 para diferentes tipos de tumores. Para esta tarea, evaluamos los niveles de MAP17 de dos formas diferentes: determinamos el nivel máximo de MAP17 encontrado en el tumor o normalizamos los niveles multiplicando la intensidad de la señal de MAP17 por el porcentaje de células positivas para calcular la puntuación (Figura 2D). Encontramos que la mayoría de los tipos de tumores mostraban una amplia gama de niveles con una mediana de 1: niveles bajos pero claros de MAP17. Sin embargo, los tumores de tipo mucinoso parecían expresar niveles muy bajos de MAP17. Sorprendentemente, los tumores benignos de adenoma no expresaron MAP17. La Figura 2E muestra el porcentaje de cada tipo de tumor que mostró positividad (en cualquier nivel) para MAP17.

La sobreexpresión de MAP17 en células tumorales Hela aumenta la captación de glucosa y el contenido de SGLT1

Resultados anteriores han demostrado que la activación de SGLT1 rescata a los enterocitos de la apoptosis celular mediante la activación de PI3K [12], y la inhibición de este transporte de membrana inhibe los aumentos y la proliferación de ROS dependientes de MAP17 [8]. Para explorar la relación de este gen con MAP17 en el cuello uterino, primero medimos la captación de glucosa en células Hela que expresan MAP17 (Figura 3A). Se encontró que la captación de glucosa aumentó un promedio de 4 veces y se inhibió con el tratamiento con el inhibidor de SGLT ploridzina. Además, encontramos que los niveles de proteína SGLT1 aumentaron un promedio de 2 veces en las células Hela que expresan MAP17 (Figura 3B).

A) La expresión de MAP17 en las células Hela aumenta la captación de glucosa que es bloqueada por el inhibidor de SGLT floridzina. B) Se realizó un análisis de transferencia Western para SGLT1 en células Hela que expresaban MAP17 o vector solo (V). C) Se muestran imágenes representativas de inmunotinción con SGLT1 de diferentes subtipos de tumores cervicales. D) Se muestra un gráfico que representa el porcentaje de tumores de cuello uterino con diferentes niveles de SGLT1. E) Se muestra un gráfico que representa el porcentaje de tumores positivos para SGLT1 por subtipo de tumor.

La sobreexpresión de SGLT1 en tumores de cuello uterino humano se correlaciona con los niveles de MAP17

Estos y otros resultados previos indican que las propiedades tumorigénicas dependientes de MAP17 dependen de la activación indirecta de ROS por el transporte de SGLT1. Por lo tanto, medimos los niveles de expresión de SGLT1 en la misma cohorte de muestras de tumores de cuello uterino.

Encontramos que los tumores mostraron tinción SLGT1 positiva (Figura 3C), con aproximadamente el 40% de los tumores positivos para SLGT1 (Figura 3D). Sin embargo, solo unas pocas muestras mostraron niveles de tinción muy altos. La distribución de los tumores SLGT1 positivos entre los diferentes tipos de tumores cervicales mostró un patrón similar al de los tumores benignos del adenoma MAP17 que eran claramente SLGT1 negativos (Figura 3E).

Dada la relación funcional entre MAP17 y SLGT1, analizamos si existía una correlación entre los niveles de expresión de ambas proteínas. Agrupamos los niveles de expresión de SGLT1 como bajo (0 & # x020130,5), medio (0,5 & # x0003cx & # x0003c1,5) o alto (& # x0003e1,5), y comparamos los grupos según los niveles de expresión de MAP17 (Anova, Prueba de Krustell-Wallis). Encontramos una correlación directa y significativa entre los niveles de MAP17 y SGLT1 dentro de los grupos (p & # x0003c0,001 Figura 4A). A continuación, comparamos los niveles de ambas proteínas en las mismas muestras de tumor y encontramos una correlación significativa (prueba de Spearman, p & # x0003c0,001) entre los niveles de ambas proteínas en la misma muestra de tumor.

A) Se muestra un gráfico que representa las correlaciones MAP17-SGLT1 en todas las muestras analizadas. Los análisis estadísticos se realizaron utilizando un ANOVA de 1 vía. B) Se muestran tres ejemplos representativos de una correlación positiva (P1, P2 y P3 son 3 muestras de tumores diferentes). Se tiñeron dos muestras de cada tumor para MAP17 y SGLT1. C) Se muestra el aumento de las cifras de P3 que se muestran en B. Las imágenes muestran la distribución de la membrana plasmática de MAP17 y SGLT1 en la muestra de tejido de muestra.

Nuevamente, observamos 2 distribuciones subcelulares diferentes para SGLT1: citoplasmática y membranosa y solo de membrana. Claramente, los patrones de distribución de SGLT1 coincidieron con los patrones de distribución de MAP17 en el mismo tumor (Figura 4B).

Los niveles de expresión de MAP17 y SGLT1 se correlacionan con la supervivencia en pacientes con tumores cervicales

Debido a que la expresión de MAP17 aumenta ROS [8], que podría estar actuando como un segundo mensajero para aumentar las propiedades tumorigénicas de las células cancerosas, planteamos la hipótesis de que aumentos adicionales en ROS podrían aumentar los niveles de ROS más allá del umbral y convertir la fisiología de las células hacia la apoptosis. . Observamos (Figura 1D) que las células Hela que sobreexpresan MAP17 aumentaron 2 veces su sensibilidad a varios fármacos quimioterapéuticos que se sabe que inducen ROS. Por tanto, MAP17 podría ser un marcador de la actividad de tratamientos donde el estrés oxidativo juega un papel clave en la respuesta, como el cisplatino o la radioterapia.

Una vez recolectadas las muestras, los pacientes de nuestra cohorte fueron tratados con el tratamiento estándar para este tipo de tumor, radioterapia (50 Gy) + braquiterapia (15 Gy) + cisplatino (6 ciclos: 40 mg / m2). Analizamos si los niveles de MAP17 influían en la respuesta a la terapia. Con ese fin, exploramos si los diferentes niveles de MAP17 se correlacionaban con la supervivencia del paciente. Las curvas de Kaplan-Meier mostraron que los pacientes con tumores con niveles medios o altos de niveles de expresión de MAP17 (puntuación normalizada & # x0003e100) mostraron una supervivencia mejorada que los pacientes con tumores con niveles bajos o nulos de MAP17 (Figura 5A). La sobreexpresión de MAP17 tuvo un claro impacto en la supervivencia del paciente (Figura 5B).

A) Se muestra una curva de Kaplan-Meier que indica que MAP17 podría ser un buen marcador pronóstico para la supervivencia en pacientes con tumor cervical tratados con cisplatino y radioterapia. B) La función de impacto indica el impacto acumulado de tener niveles altos de MAP17 en la supervivencia de pacientes con tumor de cuello uterino tratados con cisplatino y radioterapia. C) Se muestra una curva de Kaplan-Meier que indica que los niveles de SGLT1 podrían ser un buen marcador pronóstico para la supervivencia en pacientes con tumor cervical tratados con cisplatino y radioterapia. D) Se muestra una curva de Kaplan-Meier que indica que los niveles altos de MAP17 y SGLT1 son buenos marcadores de pronóstico para la supervivencia en pacientes con tumores de cuello uterino tratados con cisplatino y radioterapia.

Por lo tanto, un alto nivel de MAP17 se correlacionó con una mejor supervivencia y es un factor de buen pronóstico en el cáncer de cuello uterino tratado con radioterapia y cisplatino.

Por otro lado, estudios previos han demostrado que la inhibición del transporte de membrana SGLT1 también inhibe los aumentos y la proliferación de ROS dependientes de MAP17 [5]. Debido a que la expresión de SGLT1 se correlacionó con MAP17, estudiamos si la presencia de SGLT1 en la misma cohorte de tumores estaba relacionada con el pronóstico de forma independiente y en relación con MAP17.

Al igual que en MAP17, los niveles de SGLT1 mostraron una clara correlación con la supervivencia del paciente. Los pacientes cuyos tumores expresaban niveles medios o altos de SGLT1 (niveles normalizados & # x02265100) mostraron una supervivencia mejorada que los pacientes con niveles bajos de SGLT1 (Figura 5C). Sin embargo, la combinación de ambos marcadores mostró un claro impacto en la supervivencia del paciente. Al exhibir una combinación de niveles altos de MAP17 (& # x0003e100) y niveles altos de SGLT1 (& # x02265100), los pacientes mostraron una supervivencia completa (p & # x0003c0.001 Figura 5D), mientras que los pacientes con niveles bajos de MAP17 o SGLT1, o ambos , tuvo el peor pronóstico (Figura 5D).


Métodos

Cultivo de células

Las células TIG-3 5,20,30 se obtuvieron del Banco de Recursos de Investigación del Cáncer de Japón (JCRB) y se aislaron HSC primarias de ratón de hígado de ratón como se describió previamente 11. Estas células se cultivaron en medio de Eagle modificado de Dulbecco (DME) suplementado con suero bovino fetal (FBS) al 10%. Se cultivaron células HRPE (Lonza Inc.) y células HEK (Cell Applications Inc.) de acuerdo con las instrucciones del fabricante. Se usaron células TIG-3 de pases tempranos (menos de 40 duplicaciones de población) como células en crecimiento, y células TIG-3 de pases tardíos (más de 70 duplicaciones de población) que cesaron la proliferación se usaron como células senescentes replicativas. Para la infección retroviral, las células TIG-3 se volvieron sensibles a la infección por retrovirus ecotrópicos 5. Luego, las células se infectaron con retrovirus recombinantes que codifican Ras V12 o TREX1 (en pBabe-puro), ADNasa2 (en pMarX-puro), ADNc o ARNhc contra DP1 (en pRetrosuper – puro) 39. Después de seleccionar las células infectadas mediante selección con puromicina, se analizaron grupos de células resistentes a fármacos 7 días después de la infección. En algunos experimentos, las células se trataron con MG132 (Calbiochem) o IFN-β recombinante (PBL Assay Science) durante 12 h. En el análisis de incorporación de BrdU, las células se trataron con BrdU 20 μM (BD Pharmingen) durante 16 h 39. Las HSC se incubaron con ácido desoxicólico (Wako) durante 6 días para inducir la senescencia celular y luego LTA (InvivoGen) durante 6 h antes de la cosecha 43. Hemos confirmado la ausencia de contaminación por micoplasma en nuestras células de cultivo de tejidos.

Aislamiento de fracciones de ADN de citosol

El ADN citoplasmático se preparó modificando un método como se informó anteriormente 64. En resumen, las células se centrifugaron durante 1 min en una microcentrífuga, luego se suspendieron en tampón de sacarosa 0,3 M y se homogeneizaron con pipeteo. El homogeneizado se superpuso sobre la misma cantidad de tampón de sacarosa 1,5 M y se centrifugó a 18.506 xgramo durante 10 min. El ADN citoplásmico se purificó mediante tratamiento con proteinasa K (Wako) 0,4 mg / ml, extracción con fenol / cloroformo y precipitación con etanol con un portador (Dr. GenTLE® Precipitation Carrier, Takara Bio Inc.). La cantidad de ADN nuclear se determinó mediante PCR cuantitativa en tiempo real, utilizando tres conjuntos diferentes de cebadores diseñados para diferentes cromosomas (cromosomas humanos 3, 10 y 13, o cromosomas de ratón 1, 2 y 5) 30.

Análisis microscópico de fluorescencia

El análisis de inmunofluorescencia se realizó utilizando anticuerpos contra Lamin B1 (Abcam, ab16048, dilución 1: 1000), marcador dsDNA (Santa Cruz, sc-58749, dilución 1: 250), γ-H2AX (Millipore, 05-636, dilución 1: 2000 ), fósforo- (Ser / Thr) ATM / ATR sustrato (Cell Signaling Technology, 2851, dilución 1: 500), p16 (Santa Cruz, sc-468, dilución 1: 500), p21 (Abcam, ab2961, 1:50 dilución), 53BP1 (Santa Cruz, sc-22760 Abcam, ab36823, dilución 1: 500), IL-1β (Proteintech, 16806-1-AP, dilución 1: 300), IL-6 (Abcam, ab6672, 1: 400 dilución), STING (Abcam, ab92605, dilución 1: 200), fosfo-TBK1 (anticuerpos Bioss, bs-3440R, dilución 1: 100), IFN-β (Abcam, ab140211, dilución 1: 100), DNasa2 (anticuerpos Bioss , bs-7652, dilución 1: 100), TREX1 (Novus Biologicals, NBP1-76977, dilución 1: 100) y Desmin (Thermo Fisher Scientific, MA5-13259, dilución 1: 100). El ADN se tiñó con DAPI (Dojindo). Se observaron y fotografiaron imágenes de fluorescencia utilizando un microscopio de inmunofluorescencia (Carl Zeiss AG) 11,43.

El ARNi se realizó mediante la transfección de oligos de ARNip utilizando el reactivo de transfección Lipofectamine ™ RNAiMAX (Thermo Fisher Scientific), de acuerdo con las instrucciones del fabricante. Las secuencias de los oligos de ARNip fueron las siguientes. cGAS: GGAAGGAAAUGGUUUCCAA 35. DNasa2: CAAGAACCCUGGAACAGCAGCAUCA 36. TREX1: CCAAGACCAUCUGCUGUCA 37. Se utilizaron ARNip ON-TARGETplus para apuntar a secuencias de ARNm de Sting y ARNip de control no dirigido (Dharmacon) 30. La eficacia de la eliminación se confirmó mediante PCR cuantitativa en tiempo real.

Plásmidos

Los ADNc de DNasa2 marcados con epítopo se clonaron en el vector pMarX-retrovirus puro 5,20,30 o se clonó TREX1 en el vector pBabe-retrovirus puro. Para simplificar el ADNc marcado con bandera, se utilizaron los siguientes cebadores: DNase2, 5′-ACCGGATCCACCGCCATGGACTACAAAGACGATGACGACAAGATCCCGCTGCTGCTGGC-3 ′ (hacia adelante) y 5′-ACCCTCGAGTTAGATCTTATAAGCTCTGCTG-3 ′ (hacia atrás) y TREX1, 5′- ACCGGATCCACCGCCATGGACTACAAAGACGATGACGACAAGCAGACCCTCATCTTTTTC-3 ′ (hacia adelante) y 5′-ACCGAATTCCTACTCCCCAGGTGTGGCCAG-3 ′ (hacia atrás). Todos los ADNc se secuenciaron en un analizador genético 3130 (Applied Biosystems) usando un kit de secuenciación de ciclos BigDye Terminator v3.1 (Applied Biosystems).

PCR cuantitativa en tiempo real

El ARN total se extrajo de las células cultivadas utilizando un kit mirVana (Thermo Fisher Scientific) y luego se sometió a transcripción inversa utilizando un kit de reactivos PrimeScript RT (Takara Bio Inc.). Se realizó RT-PCR cuantitativa en tiempo real en un sistema de PCR StepOnePlus (Applied Biosystems) usando SYBR Premix Ex Taq (Takara Bio Inc.) 20,30. Las secuencias del cebador de PCR se enumeraron en la Tabla complementaria 1. Las medias ± s.d. de tres experimentos independientes se muestran.

Western blot

Para el análisis de transferencia Western, se lisaron células o tejidos de hígado de ratón en tampón de lisis (Hepes 50 mM, pH 7,5, NaCl 150 mM, EDTA 1 mM, EGTA 2,5 mM, glicerol al 10%, Tween20 al 0,1%, β-glicerofosfato 10 mM) con Cóctel inhibidor de proteasa al 1% (Nacalai Tesque) 5,20,30. La concentración de proteína se determinó usando un ensayo de proteína DC (Bio-Rad) y las proteínas se separaron mediante SDS-PAGE y se transfirieron a una membrana de PVDF (EMD Millipore). Después del bloqueo con leche al 5%, las membranas se sondaron con anticuerpos primarios de la siguiente manera: anti-H-Ras (Santa Cruz, sc-29, dilución 1: 500), c-Fos (Santa Cruz, sc-52, dilución 1: 500). ), p16 (IBL, 11104, dilución 1: 250), fosfo-RB (Tecnología de señalización celular, 9308, dilución 1: 500), RB (Santa Cruz, sc-102, dilución 1: 500), STING (Tecnología de señalización celular , 13647, dilución 1: 250), cGAS (Tecnología de señalización celular, 15102, dilución 1: 250), DNasa2 (ProSci, 2059, dilución 1: 500), TREX1 (Tecnología de señalización celular, 12215, dilución 1: 250), Lamin B1 (Santa Cruz, sc-6217, dilución 1: 500), fosfo-TBK1 (Ser172) (Tecnología de señalización celular, 5483, dilución 1: 250), TBK1 (Tecnología de señalización celular, 3013, dilución 1: 250), fosfo- IRF3 (Ser396) (tecnología de señalización celular, 4947, dilución 1: 250), IRF3 (tecnología de señalización celular, 11904, dilución 1: 250), fosfo-Erk1 / 2 (Ser396) (tecnología de señalización celular, 4376, dilución 1: 1000) ), Erk1 / 2 (tecnología de señalización celular, 4695, dilución 1: 1000), fosfo-NFκB p65 (Ser536) (Cell Tecnología de señalización, 3031, dilución 1: 250), G9a (Tecnología de señalización celular, 3306, dilución 1: 200), NFκB p65 (Santa Cruz, sc-8008, dilución 1: 500), DP1 (ICRF), p62 (MBL, PM045, dilución 1: 500), LC3 (MBL, M152-3, dilución 1: 500) y α-tubulina (SIGMA, T9026, dilución 1: 2000). Las membranas se incubaron con anticuerpos secundarios (GE Healthcare) y se visualizaron con el sustrato de máxima sensibilidad SuperSignal West Femto (Thermo Fisher Scientific).

Medición de los niveles de ROS intracelulares

Para evaluar los niveles de generación de ROS intracelulares, las células se incubaron con 20 μM de DCF-DA (Calbiochem) a 37 ° C durante 20 min. La longitud de onda de excitación máxima para DCF oxidado (488 nm) y la de emisión (525 nm) se midieron usando un contador Wallac ARVO 1420 Multilabel (PerkinElmer Co., Ltd.) 5,65.

Análisis de inmunoprecipitación de cromatina (ChIP)

El análisis de chips se realizó utilizando Dynabeads® Protein G (Thermo Fisher Scientific, 10004D) de acuerdo con las instrucciones del fabricante. Briefly, chromatin was extracted from TIG-3 cells, cross-linked with formaldehyde (final concentration 1%), and sonicated (Bioruptor, Cosmo Bio Co. Ltd.: 10 cycles of 30 s on/30 s off, on the highest setting) to generate DNA fragments 20 . The immunoprecipitation of cross-linked chromatin was conducted with anti-human E2F1 (Santa Cruz, sc-193X, 1:1000 dilution), anti-human E2F3 (Santa Cruz, sc-878X, 1:1000 dilution) and rabbit IgG (Cell Signaling Technology, 2729, 1:1000 dilution) as a negative control 66 . After immunoprecipitation, DNA was extracted using the QIAquick PCR purification kit (Qiagen) and an aliquot was amplified by real time qPCR using following primers flanking the putative human E2F-binding site position at –184 to −178 bp of human DNase2 gene promoter: 5′-CAGACTCAGCGTTGCCTTTT-3′ and 5′-CGAGGGTACAGACTCCTCCC-3′ or primers flanking the putative human E2F-binding site position at −128 to −120 of human DNase2 gene promoter: 5′-GAGGAGTCTGTACCCTCGTG-3′ and 5′-TGGCGCCTTTCACTTCCCTA-3′ or primers flanking the putative human E2F-binding site position at −573 to −566 of human TREX1 gene promoter: 5′-CAGGCCTAAACCAGGAAAGC-3′ and 5′-TCTTACACACTGCTGGGAGC-3′ or primers flanking the putative human E2F-binding site position at −260 to −252 and −232 to −224 of human TREX1 gene promoter: 5′-ATGGTGGTGAGAGGGACAGAC-3′ and 5′-AGTAGTGACTCGGCTGCACA-3′ 66 .

Animal experiments

C57/BL6 mice were purchased from CLEA Japan Inc. The sting −/− mice (C57/BL6) were kindly provided by Dr. Keiyo Takubo (National Center for Global Health and Medicine) 34 . 7,12-dimethylbenz [a]anthracene (SIGMA) treatments were performed as described previously 11,43 . In brief, 50 μl of a solution of 0.5% DMBA in acetone was applied to the dorsal surface of mice on postnatal days 4, 5. After this application, mother mice with pups were fed ND (NOSAN, Labo MR) or high-fat diet (Research Diet Inc., D12492). At the age of 4 weeks old, pups were weaned and continuously fed either ND or HFD until euthanized. Male mice with more than 45 g weight at the age of 30 weeks old were used as obese mice for all the experiments. Evaluation of tumor number and size was determined by counting the number of visible tumors and measuring the size of the tumor. The sample size used in this study was determined based on the expense of data collection, and the requirement for sufficient statistical significance. Randomisation and blinding were not used in this study. All animal care was performed according to the protocols approved by the Committee for the Use and Care of Experimental Animals of the Japanese Foundation for Cancer Research.

Statistical analysis

Statistical significance was determined using a Student’s t-test and one-way ANOVA. PAG-values less than 0.05 were considered significant.

Data availability

The data that support the findings of this study are available from the corresponding author upon reasonable request.


Molecular Imaging of Gene Therapy for Neurogenetic Diseases

John H. Wolfe , . Charles H. Vite , in Gene Therapy of the Central Nervous System , 2006

IV. GENE TRANSFER IN THE CNS

Reporter genes , such as β-galactosidase and luciferase, have played vital roles in the understanding of the molecular mechanisms of gene expression. The concept of a reporter gene provides a much simpler method for genetic analysis than the conventional hybridization techniques. A defined nucleotide sequence is introduced into a cell, whose expression results in a well-defined protein, which can be measured using the reporter probe. These reporter genes also have provided important information in the design of delivery systems in gene transfer into somatic tissue. However, monitoring these reporter systems in living animals requires either highly invasive tissue biopsy or post-mortem analysis of the animal under study. Optical imaging techniques, using GFP and luciferase, have been developed to provide non-invasive monitoring of gene expression in vivo, although these techniques are limited to either organisms which are transparent to light, or, in larger animals, to detection of gene expression near the surface of the skin ( Bhaumik and Gambhir, 2002 ). In addition, accurate quantification of the emitted light is difficult due to absorption of the light by the animal. Detection in the CNS is further compromised by the inability of light to penetrate the skull. Therefore, techniques are required which enable repetitive, non-invasive, quantitative imaging of reporter genes in living animals, which should be equally applicable to human studies.


Cell free expression systems

In cell-free expression systems, proteins are assembled in vitro using purified components of the transcription and translation machinery. These include ribosomes, RNA polymerase, tRNAs, ribonucleotides and amino acids. Cell-free expression systems are ideal for fast assembly of more than one protein in one reaction. A major advantage of these systems system is their ability to assemble proteins with labelled or modified amino acids that are useful in different downstream applications. Cell-free expression systems however, are expensive and very technically challenging to use.

Alyssa D. Cecchetelli is a Scientist at Addgene. She received her PhD from Northeastern University and is particularly interested in cell signaling and communication. She loves being able to help the scientific community share plasmids.


Engineering new vector for Metagenomics

The term ‘metagenome’ was introduced in 1998 by Handelsman etਊl. (1998), and since its first use, this methodology became a powerful tool for analysing composite genomes of microbial communities and their potential products for novel biotechnological and pharmaceutical applications. In addition, the use of functional metagenomics has been shown to be effective for identifying new enzymes, antibiotics and other molecules derived from a variety of environments without the need for isolating and cultivating microorganisms in the laboratory (Courtois etਊl., 2003 Ferrer etਊl., 2012 Pozo etਊl., 2012 Thompson etਊl., 2013 Yang etਊl., 2016).

Despite the great potential of metagenomic approaches, some barriers have limited the discovery of new genes. The probability of identifying a particular gene depends on multiple factors that are intrinsically linked: the host‐vector system, the size of the gene, the recovered metagenomic DNA abundance, the screening method and the efficiency of heterologous expression of the gene in a substitute host (the most frequently used is E.਌oli Gabor etਊl., 2004 Villegas and Kropinski, 2008 Uchiyama and Miyazaki, 2009). According to Gabor etਊl. (2004), only 40% of enzymatic activities can be recovered from random cloning in E.਌oli. This might be due to a number of factors that exist in heterologous genes that differ from those used by E.਌oli, preventing the host cell expression machinery from recognizing these signals, such as differences in translation initiation codons in E.਌oli, the preferred translation initiation codon is AUG, whereas in some organisms, GUG and UUG are preferred (Villegas and Kropinski, 2008). In addition, differences in codon usage, promoters for transcription and ribosomal binding sites may lead to no detectable expression of the target genes. Furthermore, incorrect protein folding, toxicity of the gene product and an inability to secrete the gene product may be obstacles to identifying new genes in functional screenings (Ekkers etਊl., 2012). Choosing an appropriate vector for constructing a metagenomic library depends on various factors, such as the DNA size of the expected target compound of interest, whether a small‐ or large‐insert library is considered, the hosts that will be used in the screenings, as well as the screening tests (Ekkers etਊl., 2012).

Plasmid vectors are usually chosen to generate small‐insert metagenomic libraries (<ꀐ kb average insert size), becoming an appropriate tool to identify single gene products encoded by small DNA sequences, such as enzymes and antibiotic resistance genes (Guazzaroni etਊl., 2010). Regulating the expression level of cloned genes is possible by using inducible promoters upstream of the DNA insertion site or by choosing a suitable plasmid copy number, avoiding high expression rates of toxic genes or inclusion body formation of target proteins, and low expression rates that could prevent detection in functional screenings (Hudson, 2001). Large‐insert metagenomic libraries are usually generated using cosmid or fosmid vectors and provide a more efficient method to identify complete operons and biosynthetic clusters of genes. Cosmids are vectors capable of carrying DNA inserts of about 30� kb in size that contain the cos site of λ phage for packing inserted metagenomic DNA in λ phages (Hohn and Collins, 1980). This type of vector can replicate in suitable hosts since it carries a proper origin of replication, but the lack of a copy number control mechanism usually decreases cosmid stability (Haley, 1988 Cheng etਊl., 2017). Fosmid vectors are similar to cosmids, but they use an E.਌oli F�tor origin of replication, making the fosmid copy number highly regulated to 1 or 2 copies in the cell and replication is restricted to E.਌oli (Kim etਊl., 1992 Fig.  6 ). This fact could avoid gene toxicity interference in metagenomic tests also, fosmids are capable of carrying large‐insert DNA sizes of about 40� kb (Santana‐pereira and Liles, 2017). One example of a regularly used fosmid is the pCC1FOS (Epicentre, Madison, Wisconsin), a commercial cloning vector that allows copy number to be controlled through the CopyControl Cloning System. The pCC1FOS fosmid was first introduced in metagenomic studies in 2004 in a proof‐of𠄌oncept report using a (meta)genomic library from Collimonas fungivorans (Leveau etਊl., 2004). Yet, for even larger fragments, bacterial artificial chromosomes (BACs) are used. These vectors are modified plasmids that contain an origin of replication derived from the E.਌oli F�tor and can stably maintain and replicate inserts ranging from 100 kb to 220 kb, as well as inserts of more than 300 kb, and are usually used in E.਌oli (Shizuya etਊl., 1992 Beja etਊl., 2000).

Tools based on minimal fosmids for cloning large DNA fragments. Fosmids are plasmid vectors based on the mini𠄏 origin of replication that harbour, in addition to MCS and Ab R , a cos site for DNA packing in lambda phages. This allows the cloning of very long DNA fragments (up to 50 kb) by ligation and packing into empty lambda phages. The packed DNA is then used to infect E.਌oli host strains, resulting in the construction of genomic or metagenomic DNA libraries.

Functional metagenomics: using broad‐host‐range vectors to enhance the probability of identifying target genes

An alternative to overcoming the limitations of metagenomic approaches and to enhance the discovery of new biocatalysts and molecules of interest is the use of alternative host organisms (besides E.਌oli) to perform the functional screening tests. For this, shuttle vectors and broad‐host‐range vectors have been mostly used. This type of vector (see Fig.  2 ) has been largely used in functional metagenomics, increasing the efficacy of identifying target activities (Table  2 ). Vectors used in metagenomic screening in alternative hosts contain a single broad‐host origin oriV or a multiple oriV, which permit its replication in E.਌oli and other hosts, or integrative�sed systems that allow integration of the metagenomic DNA into the chromosome of the screening host (Cheng etਊl., 2017).

Table 2

Multiple host‐vector systems for metagenomic DNA cloning and functional screening

A variety of studies have found that using diverse hosts when screening metagenomics libraries can increase the discovery rate of active clones (Table  2 ). Metagenomic libraries are often directly constructed in E.਌oli due to the higher number of transformants obtained when compared with the low rate of transformants achieved in other alternative hosts. Thus, to perform screenings in alternative hosts, a common method is to use shuttle or broad‐host‐range vectors for library construction in E.਌oli and then to transfer and screening these libraries in other host organisms. For instance, Damon etਊl. (2011) used the pFL61 yeast‐E.਌oli plasmid shuttle vector to construct a small‐insert library from soil eukaryote DNA using a metatranscriptomic approach. Performing functional complementation of a yeast mutant defective in a di/tripeptide, they identified a novel family of oligopeptide transporters expressed by fungi. Also, the pMycoFos fosmid shuttle vector has been used to allow transfer of a butane‐oxidizing strain Nocardioides CF8 DNA from E.਌oli EPI300 to Mycobacterium spp (Ly etਊl., 2011). In addition, McMahon etਊl. (2012) developed a shuttle cosmid vector for E.਌oli y Streptomyces lividans and used an optimized S. lividans strain for screening. In another study, Martinez etਊl. (2004) used a pSrps14 shuttle BAC vector and showed different functions among E.਌oli, P. putida y S. lividans expressing heterologous metagenomic genes.

On the other hand, several studies using broad‐host‐range vectors also have been reported in metagenomics screenings. For instance, Craig etਊl. (2010) described the construction of a cosmid library from soil samples in a broad‐host‐range vector (pJWC1), which was screened for antibacterial activity, altered pigmentation and altered colony morphology in six different Proteobacteria: A. tumefaciens, Burkholderia graminis, Caulobacter vibrioides, E.਌oli, P. putida y Ralstonia metallidurans. The screenings in E.਌oli identified two clones displaying antibiosis activity, but no clones displayed either pigmentation or morphology alterations, and the screenings in other hosts identifying a number of other target characteristics. This indicates that the same metagenomic library can yield different results depending on the expression host used (Craig etਊl., 2010).

Moreover, Nagayama etਊl. (2015) constructed a metagenomic library from artificially polluted soil samples using a broad‐host‐range vector (pKS13S) based on the RK2 origin of replication, showing different success rate when analysed the library in P. putida, E.਌oli y B. multivorans. Leis etਊl. (2015) used a T. thermophilus/E.਌oli shuttle fosmid vector (pCT3FK Angelov etਊl., 2009) to generate a large‐insert metagenomic library and performed screenings for lipolytic activities in E.਌oli y T. thermophilus HB2 (using a multiple clean deletion mutant T. thermophilus) which lacks several characterized extracellular and putative esterase𠄎ncoding genes. They found two thermostableਊ/b𠄏old hydrolase enzymes with high amino acid sequence similarity to already characterized enzymes in E.਌oli screening. In contrast, they found six fosmids that conferred lipolytic activities to T. thermophilus.

Additionally, in the last years, diverse efforts have been made to produce new vectors displaying relevant characteristics, and synthetic biology has become a powerful tool for this (Guazzaroni etਊl., 2015 Alves etਊl., 2017b). For instance, Bryksin and Matsumura (2010) described an engineered broad‐host‐range origin of replication (pWV01 RCR) used to create the high copy number vector pBAV1K‐T5, which can replicate in different Gram‐negative and Gram‐positive bacterial species. In another study, Terrón‐González etਊl. (2013) developed vectors and specialized E.਌oli strains as improved metagenomic DNA heterologous expression systems, which was based on the T7 RNA‐polymerase and the lambda phage transcription anti‐termination protein N (Terrón‐González etਊl., 2013). However, the approaches developed are limited to E.਌oli as a host. Another alternative to overcome the low expression of heterologous genes in functional metagenomics was proposed by Gaida etਊl. (2015). Authors created E.਌oli strains expressing heterologous sigma factors that are able to recognize heterologous promoters from metagenomic and genomic DNA libraries. The study showed that RpoD from Lactobacillus plantarum can initiate transcription from all sources of tested DNA. Moreover, the use of modular vectors, such as the pSEVA vectors listed above (Silva‐Rocha etਊl., 2013), confers diverse benefits for constructing metagenomic libraries. Yet, besides all the advantageous characteristics already mentioned, these vectors only allow the cloning of small metagenomic DNA fragments (up to 10 kb) and are not suitable for constructing large‐insert DNA libraries, which are essential for functional recovery of complete biosynthetic pathways involved in producing bioactive compounds (as in the case of non‐ribosomal peptide synthetases, polyketide synthases and terpene synthases genes, among others). Therefore, since metagenomics is a rising field, innovations in tools to facilitate manipulation and promote the discovery of functional genes in environmental samples are still needed.


Conclusiones

Creation of mammalian cell lines that express high levels of recombinant protein and maintain stable production levels over several months of cultivation is still a very time-consuming and labour-intensive process. Introduction of EEF1A-based vectors superseding CMV-based types has enabled smaller numbers of cell clones to be screened and evaluated by increasing the mean level of target protein expression. We have modified existing EEF1A-based vectors by linking the DHFR selection marker and target gene in the bicistronic RNA, shortening the overall plasmid size, and adding an EBVTR element. The presence of an EBVTR element in the resulting p1.1 vector increased the stable transfection rate by a factor of 24, and increased the target protein expression level by eight-fold using a single round of MTX-driven target gene amplification. Two consecutive rounds of MTX-driven amplification, performed for suspension culture, resulted in the polyclonal cell population with the eGFP expression level comprising 9.0% of the total cytoplasmic protein. Compatible vectors bearing antibiotic resistance markers instead of the DHFR gene were created and found to be approximately equal to the DHFR-based vector for generation of highly productive cell populations. We found that the EEF1A-based vector, p1.2-Hygro, containing the hygromycin selection marker, allowed direct generation of a polyclonal cell population that was nearly devoid of eGFP-negative cells, while eGFP expression comprised up to 8.9% of the total cytoplasmic protein. This level of eGFP expression corresponds to only 30 copies of the target gene per single haploid genome, in contrast to CMV-based vectors that have thousands of copies per genome in highly productive lines [19]. The set of vectors developed herein allows generation of highly productive and stable cell clones with limited effort and such vectors may be employed to create cell lines for production of biosimilar pharmaceuticals. p1.1 or p1.2-based plasmids, stably transfected into polyclonal cell populations expressing large quantities of target proteins at a scale of 4–6*10 7 cells, can be generated in less than one month by simple periodic passage of a culture from a shaking flask. This technique may be useful for obtaining milligram quantities of mutants of a protein of interest or for evaluation of several mAb clones. Cells from these polyclonal populations may be also used for direct development of industrially applicable clonal cell lines by limiting dilution.


Ver el vídeo: Vectores de clonación y expresión. (Junio 2022).