Información

RT-PCR: sin ver cómo puede medir los niveles de expresión de ARNm

RT-PCR: sin ver cómo puede medir los niveles de expresión de ARNm


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Según tengo entendido, en RT-PCR comenzamos con una molécula de ARNm, usamos la enzima transcriptasa inversa para crear una copia de ADNc (creando así un híbrido de ARNm / ADNc bicatenario), degradamos el ARNm y finalmente creamos una cadena complementaria para el ADNc con una ADN polimerasa. Si finalmente estamos creando ADN y se está duplicando en cada ciclo, ¿cómo podemos deducir la cantidad original de ARNm en nuestra muestra? Parece que necesitaríamos combinarlo con algún otro método, pero muchas fuentes que estoy viendo parecen implicar que la RT-PCR por sí sola es suficiente para "cuantificar" la cantidad de ARNm en una muestra. Cualquier pensamiento sobre esto es bienvenido


Puede haber una confusión de terminología. Existe una PCR cuantitativa en tiempo real, que a veces se puede llamar RT-PCR. También existe la PCR con transcriptasa inversa, que también se denomina de manera confusa RT-PCR. Para tratar de reducir la confusión, la PCR cuantitativa en tiempo real también se denomina RT-qPCR o qPCR.

Lo que describe en su pregunta es el tipo de PCR con transcriptasa inversa. Se utiliza para la amplificación, no para la cuantificación, del material de partida.

QPCR o PCR cuantitativa, por otro lado, utiliza tintes fluorescentes para medir la cantidad de producto génico amplificado. Los estándares proporcionan una medida de referencia de la cantidad de material genético que debe esperar ver con el tiempo, en cada ciclo de PCR, para una determinada cantidad de fluorescencia medida. Medir la fluorescencia de su propia muestra a lo largo del tiempo y compararla con el estándar le da una estimación de lo que comenzó inicialmente.


Solo quería ampliar la respuesta anterior con respecto a la confusión entre la PCR en tiempo real (cuantitativa) y la transcripción inversa (RT). RT-qPCR se refiere a PCR cuantitativa en tiempo real, pero algunas organizaciones se abstienen de cualquier referencia a la cuantificación (porque en realidad es solo semicuantitativa), en su lugar utilizan la nomenclatura rRT-PCR (PCR en tiempo real de transcripción inversa, supongo). En cualquier caso, esta técnica es teóricamente capaz de cuantificar las copias de ARNm utilizando el diseño de ensayo y los estándares adecuados.

El principio general es que, después de que el ADNc se transcribe de forma inversa a partir del ARN, se amplifica de manera similar a una reacción de PCR normal. Esto se puede lograr en una sola reacción con una mezcla maestra que contiene los reactivos de transcripción inversa y qPCR, o en dos reacciones separadas, primero realizando una RT primero y luego una qPCR estándar en el ADNc resultante. El método todo en uno requiere menos reactivos y menos tiempo, pero puede ser difícil optimizar ambas reacciones al mismo tiempo.

Aquí hay una buena introducción al diseño de ensayos de qPCR. Como se indicó en la respuesta anterior, la cuantificación proviene de alguna medida de fluorescencia relacionada con la cantidad de producto de amplificación presente. En una reacción optimizada, el número de amplicones debe duplicarse con cada ciclo, lo que permite la cuantificación en función de cuántos ciclos ocurren antes de que cada pozo de reacción alcance un umbral de fluorescencia específico. Los colorantes intercalados como SyberGreen cuantifican el ADN total presente, mientras que las sondas fluorescentes son más específicas para el gen de interés. Debido a que es solo semicuantitativo, se incluye una serie de diluciones estándar de concentración conocida en cada placa y se utiliza para la cuantificación. Los estándares deben ser del mismo material y secuencia que su gen de interés (ADN o ARN) y deben diluirse en un rango de concentraciones que probablemente incluirán la concentración en sus muestras experimentales. También debe tener cuidado con la posibilidad de degradación de sus estándares, ya que la calidad de su cuantificación depende completamente de la calidad de sus estándares.

Un enfoque alternativo es cuantificar un gen de interés en relación con algún gen de referencia que se expresa de forma constitutiva en el mismo nivel independientemente de la muestra experimental. Este método (a veces llamado método delta-delta Ct) elimina la necesidad de ejecutar una curva estándar, pero requiere reacciones adicionales o multiplexación, además de identificar un gen de referencia estable con cebadores y posiblemente sondas que funcionarán bajo las mismas condiciones de termociclado que su gen de interés.

Una tercera opción es la cuantificación absoluta mediante PCR digital (dPCR). Un problema con qPCR en general es que, incluso cuando se procesan muestras por duplicado o triplicado, puede ser difícil resolver con seguridad las diferencias en la cuantificación menores de aproximadamente 3 veces. Ingrese cuantificación absoluta. El dPCR funciona dividiendo la reacción en decenas de miles de compartimentos de tamaño nanométrico, de modo que cada compartimento puede contener o no una copia real de su gen de interés. La fluorescencia solo se usa al final de la reacción para determinar si cada compartimento se ha amplificado o no (por lo tanto, digital, cada compartimento es un 1 o un 0). La cuantificación se calcula determinando la proporción de compartimentos positivos a negativos y comparándola con una distribución de Poisson para distribuciones de probabilidad discretas. Puede tener una resolución mucho más fina que la qPCR, supuestamente capaz de detectar de manera confiable una diferencia de 1,2 veces en las concentraciones, con la desventaja de que tiene un rango menos dinámico con una confianza reducida en las estimaciones de cuantificación cerca de la parte superior e inferior de ese rango. Además, todo el sistema suele ser mucho más caro en casi todos los niveles (equipo, reactivos y consumibles). Pero con la mayoría de los ensayos de expresión génica, realmente debe preguntarse si un cambio de 1,2 veces en el nivel de transcripción será significativo en su sistema biológico.


Cuantificación relativa de ARNm: comparación de métodos utilizados actualmente para el análisis de datos de PCR en tiempo real

Los datos fluorescentes obtenidos de la PCR en tiempo real deben procesarse mediante algún método de análisis de datos para obtener la cantidad relativa de ARNm diana. El método elegido para el análisis de datos puede influir mucho en los resultados de la cuantificación.

Resultados

Para comparar el rendimiento de seis técnicas que se utilizan actualmente para analizar datos fluorescentes en cuantificación relativa de PCR en tiempo real, cuantificamos cuatro transcripciones de citocinas (IL-1β, IL-6 TNF-α y GM-CSF) en un en vivo modelo de inflamación colónica. La precisión de los métodos se probó mediante cuantificación en muestras con cantidades relativas conocidas de ARNm diana. La reproducibilidad de los métodos se estimó mediante la determinación de la variabilidad intraensayo e interensayo. A continuación, se determinó la expresión de citocinas normalizada a la expresión de tres genes de referencia (ACTB, HPRT, SDHA) usando los seis métodos para el análisis de datos. Los mejores resultados se obtuvieron con el método de curva estándar relativa, el método Ct comparativo y con los métodos exponenciales DART-PCR, LinRegPCR y Liu & amp Saint cuando se utilizó la eficiencia de amplificación promedio. El uso de eficiencias de amplificación individual en los métodos exponenciales DART-PCR, LinRegPCR y Liu & amp Saint perjudicó significativamente los resultados. El método de ajuste de curva sigmoidea (SCF) produjo un rendimiento medio; los resultados indican que el uso del tipo apropiado de datos de fluorescencia y, en algunos casos, la selección manual del número de ciclos de amplificación incluidos en el análisis es necesario cuando se aplica el método SCF. También comparamos las eficiencias de amplificación (E) y encontramos que aunque los valores de E determinados por diferentes métodos de análisis no eran idénticos, todos los métodos fueron capaces de identificar dos genes cuyos valores de E diferían significativamente de otros genes.

Conclusión

Nuestros resultados muestran que todos los métodos probados pueden proporcionar valores cuantitativos que reflejan las cantidades de ARNm medido en las muestras, pero difieren en su precisión y reproducibilidad. La selección del método apropiado también puede depender del diseño de un experimento en particular. Se discuten las ventajas y desventajas de los métodos en diferentes aplicaciones.


Expresión génica que varía con el transcurso del tiempo cuando no debería & # 39t (qRT-PCR) - (12 / Ago / 2014)

Hola, estoy teniendo algunos problemas con mis experimentos, así que si alguien tiene alguna idea, ¡házmelo saber!

He estado transfectando células transitoriamente con mi gen de interés, esperando 24 horas y luego extrayendo el ARN total y usando qRT-PCR para medir su expresión.

Estoy tratando de optimizar un experimento de curso temporal en el que finalmente inhibo la transcripción usando un medicamento (por ejemplo, DRB) y extraigo el ARN total durante un período de tiempo para medir la tasa de degradación de la transcripción del gen que me interesa.

Hasta ahora, he estado intentando extraer ARN de células sin inhibición de la transcripción durante un período de 8 horas, comenzando 24 horas después de la transfección (las células han alcanzado el 100% de confluencia). Esperaba que el aumento de veces (2 ^ ddCt) en la expresión por encima del ADN endógeno se mantuviera bastante estable a lo largo del tiempo, pero he obtenido resultados increíbles.

Por ejemplo, a las 0 horas el aumento de veces fue 157, luego 60 a las 2 horas, 68 a las 4 horas, luego hasta 229 a las 8 horas. En otras carreras también obtuve resultados extraños que no permanecen constantes a lo largo del tiempo.

No sé cómo explicar esto, o qué cambiar en mis métodos para obtener diferencias de pliegue constantes en los puntos de tiempo. No creo que sea contaminación de ADN, ya que tomo DNasa las muestras y verifico si hay contaminación residual con una electroforesis en gel / PCR estándar. Tampoco estoy convencido de que sea una degradación del ARN, ya que las bandas que obtengo cuando ejecuto las muestras en un gel son bastante buenas (aunque un poco borrosas).

Mi único otro pensamiento es que podría deberse al ciclo celular, o porque las células están estresadas al 100% de confluencia y se comportan de manera extraña.

Si alguien tiene alguna idea, hágamelo saber :)

Hasta donde yo sé, la expresión génica puede variar mucho con el tiempo, dependiendo de una amplia gama de factores como la edad celular, la etapa del ciclo celular, el estado general de la célula, el medio celular, etc. ver una expresión estable a lo largo del tiempo es seguro. Por lo general, son solo los genes domésticos los que hacen esto.

- ¿Hay otros investigadores que hayan analizado la expresión de este gen antes en células transfectadas?

- ¿Qué tipo de gen es? ¿En qué procesos está involucrado?

- ¿Los cambios de pliegue que ve en los puntos de tiempo 0, 2, 4 y 8 horas son reproducibles entre experimentos?

- ¿Su amplificación es específica? ¿Ves bandas adicionales cuando pones las muestras en gel?

- Suponga que los aumentos de veces que ve son confiables, y la expresión de su gen de interés es solo esa variable, ¿incubar sus células con su medicamento inhibidor de la transcripción produce una respuesta dependiente de la dosis?

¿Tiene un agente de selección para su vector que contiene el gen? Porque las celdas lo perderán aleatoriamente de lo contrario. & # 160

Y como supongo que no tiene las "mismas" celdas analizadas en los puntos de tiempo, ¿tiene matraces separados para cada punto de tiempo o toma parte de uno más grande?

Necesita saber qué tan estable es el vector en sus células. Puede hacerlo analizando también el ADN (de las células, más el vector, más el gen) mediante qPCR midiendo el porcentaje de un gen de la célula (puede ser algún gen de copia única, como GAPDH) y alguna secuencia en el vector (posiblemente parte de su gen y parte del vector, para que sepa que no está ampliando nada de lo que había en las células).

Puede ver si la ración se mantiene constante. Si es así, los cambios en la expresión son solo a nivel de transcripción (o un problema con una detección, detección inespecífica).

Si la proporción varía, las células pierden el vector desde el que transcribir.

SusieQ el miércoles 13 de agosto 07:16:03 2014 dijo:

Hasta donde yo sé, la expresión génica puede variar mucho con el tiempo, dependiendo de una amplia gama de factores como la edad celular, la etapa del ciclo celular, el estado general de la célula, el medio celular, etc. ver una expresión estable a lo largo del tiempo es seguro. Por lo general, son solo los genes domésticos los que hacen esto.

 

- ¿Hay otros investigadores que hayan analizado la expresión de este gen antes en células transfectadas?

- ¿Qué tipo de gen es? ¿En qué procesos está involucrado?

- ¿Los cambios de pliegue que ve en los puntos de tiempo 0, 2, 4 y 8 horas son reproducibles entre experimentos?

- ¿Su amplificación es específica? ¿Ves bandas adicionales cuando pones las muestras en gel?

- Suponga que los aumentos de veces que ve son confiables, y la expresión de su gen de interés es solo esa variable, ¿incubar sus células con su medicamento inhibidor de la transcripción produce una respuesta dependiente de la dosis?

He estado usando ABCE1 y PPPR18 como genes de mantenimiento (estos se seleccionaron en función de los datos de microarrays de Gene Investigator). He intentado este experimento dos veces hasta ahora: la primera vez que los genes de mantenimiento de la casa parecen permanecer constantes entre los puntos de tiempo de 0, 2, 4 y 8 horas. La segunda vez, los genes domésticos mostraron una expresión reducida a lo largo de los períodos de tiempo. En ambas ocasiones, la expresión de mi gen de interés ha variado entre puntos de tiempo y nunca es consistente, p. Ej. en un experimento mostró una disminución en la expresión génica de 0 a 4 horas, y luego un aumento en la expresión a las 8 horas.

El gen que estoy viendo es Zic2, que es un factor de transcripción. Nadie más ha mirado sus niveles de expresión de ARNm antes (que sepamos).

La amplificación que vemos es específica. Los antiguos miembros del laboratorio han utilizado los cebadores para amplificar la región de Zic2 que estoy investigando.

La incubación de las células con DRB tampoco parece producir un resultado consistente. Hemos estado usando DRB 75 mM por pocillo (en una placa de 6 pocillos) y esto hace que un gen de mantenimiento aumente su expresión mientras que el otro muestra una reducción en la expresión y mi gen de interés no muestra ningún cambio real. Esta concentración se tomó de otros artículos publicados que también utilizaron DRB.

Esperamos ver una reducción constante en la expresión de ARNm de nuestro gen Zic2 para que podamos medir su tasa de descomposición, sin embargo, nuestros datos hasta ahora parecen sugerir que nuestros niveles de expresión no son consistentes incluso sin la DRB agregada a las células. Dado que nadie en nuestra institución ha realizado experimentos similares antes, no estamos seguros de si necesitamos que los puntos de tiempo que no son de DRB sean consistentes o no para medir con precisión nuestra tasa de descomposición.

¡Se agradece cualquier consejo que puedas dar!

Trof el miércoles 13 de agosto 14:22:22 2014 dijo:

¿Tiene un agente de selección para su vector que contiene el gen? Porque las celdas lo perderán aleatoriamente de lo contrario. & # 160

 

Y como supongo que no tiene las "mismas" celdas analizadas en los puntos de tiempo, ¿tiene matraces separados para cada punto de tiempo o toma parte de uno más grande?

 

Necesita saber qué tan estable es el vector en sus células. Puede hacerlo analizando también el ADN (de las células, más el vector, más el gen) mediante qPCR midiendo el porcentaje de un gen de la célula (puede ser algún gen de copia única, como GAPDH) y alguna secuencia en el vector (posiblemente parte de su gen y parte del vector, para que sepa que no está ampliando nada de lo que había en las células).

Puede ver si la ración se mantiene constante. Si es así, los cambios en la expresión son solo a nivel de transcripción (o un problema con una detección, detección inespecífica).

 

Si la proporción varía, las células pierden el vector desde el que transcribir.

No hemos estado usando un agente de selección para nuestro constructo que contiene células. Tenemos una antigua reserva de antibióticos que podríamos usar, pero desconfiamos de que interactúen con la DRB que estamos usando para tratar nuestras células. Dado que solo dejamos las células durante 24 horas después de la transfección antes de agregar el DRB, ¿es ese tiempo suficiente para que las células eliminen el plásmido? Dejamos nuestras células transfectadas durante 24 horas antes de realizar otros experimentos como los ensayos de luciferasa y nunca hemos detectado un problema con el plásmido que se desecha.

Tenemos pozos separados en una placa de 12 pocillos que usamos en cada momento. Todos estos provienen del mismo matraz original que luego se divide entre los pocillos y luego cada pocillo se transfecta individualmente. Estamos considerando transfectar primero y luego dividir las células transfectadas entre los 12 pozos, pero aún no hemos tenido la oportunidad de probar este método y ver si ayuda con la variación en la expresión génica.

En mi qRT-PCR también incluyo 2 genes de mantenimiento para la normalización. Los cebadores para mi gen de interés solo se unen a mi gen de interés, no a la columna vertebral del vector, pero resto el valor de dCT de las células no transfectadas del dCT de las células transfectadas para intentar explicar la expresión endógena del gen de interés. ¿Este método elimina también la necesidad de amplificar la columna vertebral del vector?

Primer pensamiento: ¿Por qué está utilizando un plásmido para expresar su Zic2 cuando también se expresa de forma endógena? ¿Quiere modificar la transcripción para ver si se requieren ciertas regiones para su estabilidad?

Creo que el proceso de transfección puede tener una gran influencia en los niveles que ves. Supongo que realiza la transfección en diferentes pozos y que luego usa un pozo en cada punto de tiempo para la lisis y la extracción de ARN. Las diferencias en la eficiencia de la transfección también influirán en los niveles de ARNm que ve en su qPCR. Para evitar esto, puede transfectar un grupo de células y dividirlas en diferentes pocillos al día siguiente. Aunque seguirá obteniendo variación, debería ser menor.

Usted controla la presencia de ADN realizando una PCR estándar y un gel. ¿Por qué no haces una qPCR con estas muestras -RT? Esto es mucho más sensible que el gel que estás usando.

Un último pensamiento: das razones para el Zic2 sobreexpresado frente al Zic2 endógeno, pero cuando la expresión endógena es realmente baja (Ct & gt30), es muy fácil obtener diferencias dobles al dividir por un número pequeño que tiene un mucha variación intrínseca.

dpo el jueves 14 de agosto 06:41:37 2014 dijo:

Primer pensamiento: ¿Por qué está utilizando un plásmido para expresar su Zic2 cuando también se expresa de forma endógena? ¿Quiere modificar la transcripción para ver si se requieren ciertas regiones para su estabilidad?

 

Creo que el proceso de transfección puede tener una gran influencia en los niveles que ves. Supongo que realiza la transfección en diferentes pozos y que luego usa un pozo en cada punto de tiempo para la lisis y la extracción de ARN. Las diferencias en la eficiencia de la transfección también influirán en los niveles de ARNm que ve en su qPCR. Para evitar esto, puede transfectar un grupo de células y dividirlas en diferentes pocillos al día siguiente. Aunque seguirá obteniendo variación, debería ser menor.

 

Usted controla la presencia de ADN realizando una PCR estándar y un gel. ¿Por qué no haces una qPCR con estas muestras -RT? Esto es mucho más sensible que el gel que estás usando.

 

Un último pensamiento: das razones para el Zic2 sobreexpresado frente al Zic2 endógeno, pero cuando la expresión endógena es realmente baja (Ct & gt30), es muy fácil obtener diferencias dobles al dividir por un número pequeño que tiene un mucha variación intrínseca.

Lo siento por la respuesta tardía. Así es, estoy modificando la transcripción para examinar cómo las diferentes regiones impactan en la estabilidad.

Comencé a transfectar grupos de células y luego a dividirlos en pozos individuales, así que espero que esto reduzca la variación entre la eficiencia de la transfección. Gracias por la sugerencia.

Acabo de hacer la PCR estándar para detectar ADN, en lugar de un control -RT para reducir los costos en este momento. He incluido este control en mis intentos iniciales de realizar este experimento y parecía que las muestras estaban libres de ADN. Una vez que los experimentos vuelvan a funcionar y produzcan buenos datos, comenzaré a incluirlos nuevamente.

El Ct para la expresión endógena tiende a estar a mediados de los años 20. Estoy planeando buscar diferentes fórmulas para calcular el cambio de veces a partir de mis datos, ya que sé que el ddCt tiene algunos inconvenientes, como usar solo un gen de control y requerir que todas las reacciones tengan la misma eficiencia. Así que, con suerte, podré encontrar algo que tenga en cuenta todas estas cosas.


Referencias

O'Farrell PH: Electroforesis bidimensional de proteínas de alta resolución. J Biol Chem. 1975, 250: 4007-4021.

Klose J: mapeo de proteínas mediante enfoque isoeléctrico combinado y electroforesis de tejidos de ratón. Un enfoque novedoso para las pruebas de mutaciones puntuales inducidas en mamíferos. Humangenetik. 1975, 26: 231-243.

Hatzimanikatis V, Choe LH, Lee KH: Proteómica: consideraciones teóricas y experimentales. Biotechnol Prog. 1999, 15: 312-318. 10.1021 / bp990004b.

Schena M, Heller RA, Theriault TP, Konrad K, Lachenmeier E, Davis RW: Microarrays: plataforma de descubrimiento de biotecnología para genómica funcional. Trends Biotechnol. 1998, 16: 301-306. 10.1016 / S0167-7799 (98) 01219-0.

McGall GH, Christians FC: matrices de sondas de oligonucleótidos de chip genético de alta densidad. Adv Biochem Eng Biotechnol. 2002, 77: 21-42.

Brown PO, Botstein D: Explorando el nuevo mundo del genoma con microarrays de ADN. Nat Genet. 1999, 21: 33-37. 10.1038 / 4462.

Gygi SP, Rochon Y, Franza BR, Aebersold R: Correlación entre la abundancia de proteínas y ARNm en levaduras. Mol Cell Biol. 1999, 19: 1720-1730.

Gygi SP, Corthals GL, Zhang Y, Rochon Y, Aebersold R: Evaluación de la tecnología de análisis de proteomas basada en electroforesis en gel bidimensional. Proc Natl Acad Sci USA. 2000, 97: 9390-9395. 10.1073 / pnas.160270797.

Tonge R, Shaw J, Middleton B, Rowlinson R, Rayner S, Young J, Pognan F, Hawkins E, Currie I, Davison M: Validación y desarrollo de la tecnología proteómica de electroforesis diferencial bidimensional en gel de fluorescencia. Proteómica. 2001, 1: 377-396. 10.1002 / 1615-9861 (200103) 1: 3 & lt377 :: AID-PROT377 & gt3.3.CO2-Y.

Gharbi S, Gaffney P, Yang A, Zvelebil MJ, Cramer R, Waterfield MD, Timms JF: Evaluación de electroforesis en gel diferencial bidimensional para el análisis de expresión proteómica de un sistema de células de cáncer de mama modelo. Proteómica de células mol. 2002, 1: 91-98. 10.1074 / mcp.T100007-MCP200.

Zhou G, Li H, DeCamp D, Chen S, Shu H, Gong Y, Flaig M, Gillespie JW, Hu N, Taylor PR, et al: Electroforesis diferencial 2D en gel para la identificación de proteínas específicas de cáncer de células de barridos de esófago marcadores. Proteómica de células mol. 2002, 1: 117-124. 10.1074 / mcp.M100015-MCP200.

Adam BL, Vlahou A, Semmes OJ, Wright GL: enfoques proteómicos para el descubrimiento de biomarcadores en cánceres de próstata y vejiga. Proteómica. 2001, 1: 1264-1270. 10.1002 / 1615-9861 (200110) 1: 10 & lt1264 :: AID-PROT1264 & gt3.3.CO2-I.

Issaq HJ, Veenstra TD, Conrads TP, Felschow D: El enfoque SELDI-TOF MS para la proteómica: perfil de proteínas e identificación de biomarcadores. Biochem Biophys Res Commun. 2002, 292: 587-592. 10.1006 / bbrc.2002.6678.

Petricoin EF, Ardekani AM, Hitt BA, Levine PJ, Fusaro VA, Steinberg SM, Mills GB, Simone C, Fishman DA, Kohn EC, et al: Uso de patrones proteómicos en suero para identificar el cáncer de ovario. Lanceta. 2002, 359: 572-577. 10.1016 / S0140-6736 (02) 07746-2.

Li J, Zhang Z, Rosenzweig J, Wang YY, Chan DW: Enfoques proteómicos y bioinformáticos para la identificación de biomarcadores séricos para detectar el cáncer de mama. Clin Chem. 2002, 48: 1296-1304.

Wu B, Abbott T, Fishman D, McMurray W, Mor G, Stone K, Ward D, Williams K, Zhao H: Comparación de métodos estadísticos para la clasificación del cáncer de ovario utilizando datos de espectrometría de masas. Bioinformática.

Han DK, Eng J, Zhou H, Aebersold R: perfil cuantitativo de proteínas microsomales inducidas por diferenciación utilizando etiquetas de afinidad codificadas por isótopos y espectrometría de masas. Nat Biotechnol. 2001, 19: 946-951. 10.1038 / nbt1001-946.

Wolters DA, Washburn MP, Yates JR: una tecnología de identificación de proteínas multidimensional automatizada para la proteómica de escopeta. Anal Chem. 2001, 73: 5683-5690. 10.1021 / ac010617e.

Washburn MP, Ulaszek R, Deciu C, Schieltz DM, Yates JR: Análisis de datos proteómicos cuantitativos generados mediante tecnología de identificación de proteínas multidimensional. Anal Chem. 2002, 74: 1650-1657. 10.1021 / ac015704l.

Washburn MP, Koller A, Oshiro G, Ulaszek RR, Plouffe D, Deciu C, Winzeler E, Yates JR: Vía de proteínas y agrupación compleja de ARNm correlacionado y análisis de expresión de proteínas en Saccharomyces cerevisiae. Proc Natl Acad Sci USA. 2003, 100: 3107-3112. 10.1073 / pnas.0634629100.

Golub TR, Slonim DK, Tamayo P, Huard C, Gaasenbeek M, Mesirov JP, Coller H, Loh ML, Downing JR, Caligiuri MA, et al: Clasificación molecular del cáncer: descubrimiento de clases y predicción de clases mediante el control de la expresión génica. Ciencias. 1999, 286: 531-537. 10.1126 / science.286.5439.531.

Macgregor PF, Squire JA: Aplicación de microarrays al análisis de la expresión génica en el cáncer. Clin Chem. 2002, 48: 1170-1177.

Anderson L, Seilhamer J: Una comparación de abundancias de ARNm y proteínas seleccionados en el hígado humano. Electroforesis. 1997, 18: 533-537.

Lichtinghagen R, Musholt PB, Lein M, Romer A, Rudolph B, Kristiansen G, Hauptmann S, Schnorr D, Loening SA, Jung K: Expresión de ARNm y proteínas diferentes de las metaloproteinasas 2 y 9 de la matriz e inhibidor tisular de las metaloproteinasas 1 en benignos y tejido prostático maligno. Eur Urol. 2002, 42: 398-406. 10.1016 / S0302-2838 (02) 00324-X.

Chen G, Gharib TG, Huang CC, Taylor JM, Misek DE, Kardia SL, Giordano TJ, Iannettoni MD, Orringer MB, Hanash SM, et al: Expresión discordante de proteínas y ARNm en adenocarcinomas de pulmón. Proteómica de células mol. 2002, 1: 304-313. 10.1074 / mcp.M200008-MCP200.

Orntoft TF, Thykjaer T, Waldman FM, Wolf H, Celis JE: estudio de todo el genoma del número de copias de genes, transcripciones y niveles de proteínas en pares de carcinomas de células de transición humanos no invasivos e invasivos. Proteómica de células mol. 2002, 1: 37-45. 10.1074 / mcp.M100019-MCP200.

Futcher B, Latter GI, Monardo P, McLaughlin CS, Garrels JI: una muestra del proteoma de levadura. Mol Cell Biol. 1999, 19: 7357-7368.

Greenbaum D, Jansen R, Gerstein M: Análisis de la expresión de ARNm y datos de abundancia de proteínas: un enfoque para la comparación del enriquecimiento de características en la población celular de proteínas y transcripciones. Bioinformática. 2002, 18: 585-596. 10.1093 / bioinformatics / 18.4.585.

Greenbaum D, Luscombe NM, Jansen R, Qian J, Gerstein M: Interrelación de diferentes tipos de datos genómicos, desde el proteoma hasta el secretoma: 'entrando en función. Genome Res. 2001, 11: 1463-1468. 10.1101 / gr.207401.

Washburn MP, Wolters D, Yates JR: análisis a gran escala del proteoma de levadura mediante tecnología de identificación de proteínas multidimensional. Nat Biotechnol. 2001, 19: 242-247. 10.1038 / 85686.

Peng J, Elias JE, Thoreen CC, Licklider LJ, Gygi SP: Evaluación de cromatografía multidimensional acoplada con espectrometría de masas en tándem (LC / LC-MS / MS) para análisis de proteínas a gran escala: el proteoma de levadura. J Proteome Res. 2003, 2: 43-50. 10.1021 / pr025556v.

Mewes HW, Frishman D, Guldener U, Mannhaupt G, Mayer K, Mokrejs M, Morgenstern B, Munsterkotter M, Rudd S, Weil B: MIPS: una base de datos para genomas y secuencias de proteínas. Ácidos nucleicos Res. 2002, 30: 31-34. 10.1093 / nar / 30.1.31.

Baldi P, Long AD: un marco bayesiano para el análisis de datos de expresión de microarrays: prueba t regularizada e inferencias estadísticas de cambios genéticos. Bioinformática. 2001, 17: 509-519. 10.1093 / bioinformatics / 17.6.509.

Szallasi Z: análisis de redes genéticas a la luz de la adquisición masiva de datos biológicos paralelos. Pac Symp Biocomput. 1999, 5-16.

Cho RJ, Campbell MJ, Winzeler EA, Steinmetz L, Conway A, Wodicka L, Wolfsberg TG, Gabrielian AE, Landsman D, Lockhart DJ, et al: Un análisis transcripcional de todo el genoma del ciclo celular mitótico. Mol Cell. 1998, 2: 65-73.

Arava Y, Wang Y, Storey JD, Liu CL, Brown PO, Herschlag D: análisis de todo el genoma de los perfiles de traducción de ARNm en Saccharomyces cerevisiae. Proc Natl Acad Sci USA. 2003, 100: 3889-3894. 10.1073 / pnas.0635171100.

Glickman MH, Ciechanover A: La vía proteolítica de ubiquitina-proteasoma: destrucción en aras de la construcción. Physiol Rev. 2002, 82: 373-428.

Pratt JM, Petty J, Riba-García I, Robertson DH, Gaskell SJ, Oliver SG, Beynon RJ: Dinámica del recambio de proteínas, una dimensión faltante en la proteómica. Proteómica de células mol. 2002, 1: 579-591. 10.1074 / mcp.M200046-MCP200.

Lian Z, Kluger Y, Greenbaum DS, Tuck D, Gerstein M, Berliner N, Weissman SM, Newburger PE: análisis genómico y proteómico del programa de diferenciación mieloide: análisis global de la expresión génica durante la diferenciación inducida en la línea celular MPRO. Sangre. 2002, 100: 3209-3220. 10.1182 / sangre-2002-03-0850.

Gerner C, Vejda S, Gelbmann D, Bayer E, Gotzmann J, Schulte-Hermann R, Mikulits W: Determinación concomitante de valores absolutos de cantidades de proteínas celulares, tasas de síntesis y tasas de recambio mediante perfiles cuantitativos de proteomas. Proteómica de células mol. 2002, 1: 528-537. 10.1074 / mcp.M200026-MCP200.

Serikawa KA, Xu XL, MacKay VL, Law GL, Zong Q, Zhao LP, Bumgarner R, Morris DR: El transcriptoma y su traducción durante la recuperación de la detención del ciclo celular en Saccharomyces cerevisiae. Proteómica de células mol. 2003, 2: 191-204. 10.1074 / mcp.D200002-MCP200.

Bennetzen JL, Hall BD: Selección de codones en levadura. J Biol Chem. 1982, 257: 3026-3031.

Sharp PM, Li WH: El índice de adaptación de codones: una medida del sesgo de uso de codones sinónimos direccionales y sus aplicaciones potenciales. Ácidos nucleicos Res. 1987, 15: 1281-1295.

Jansen R, Bussemaker HJ, Gerstein M: Revisando el índice de adaptación de codones desde una perspectiva de genoma completo: análisis de la relación entre la expresión génica y la ocurrencia de codones en levadura utilizando una variedad de modelos. Ácidos nucleicos Res. 2003, 31: 2242-2251. 10.1093 / nar / gkg306.

Coghlan A, Wolfe KH: Relación del sesgo de codón con la concentración de ARNm y la longitud de la proteína en Saccharomyces cerevisiae. Levadura. 2000, 16: 1131-1145. 10.1002 / 1097-0061 (20000915) 16: 12 & lt1131 :: AID-YEA609 & gt3.0.CO2-F.

Jansen R, Greenbaum D, Gerstein M: Relacionar datos de expresión del genoma completo con interacciones proteína-proteína. Genome Res. 2002, 12: 37-46. 10.1101 / gr.205602.

Qian J, Kluger Y, Yu H, Gerstein M: Identificación y corrección de correlaciones espaciales falsas en datos de microarrays. Biotecnologías. 2003, 35: 42-44.

Yan JX, Devenish AT, Wait R, Stone T, Lewis S, Fowler S: electroforesis en gel de diferencia bidimensional de fluorescencia y análisis proteómico basado en espectrometría de masas de Escherichia coli. Proteómica. 2002, 2: 1682-98. 10.1002 / 1615-9861 (200212) 2: 12 & lt1682 :: AID-PROT1682 & gt3.0.CO2-Y.

Kumar A, Agarwal S, Heyman JA, Matson S, Heidtman M, Piccirillo S, Umansky L, Drawid A, Jansen R, Liu Y, et al: localización subcelular del proteoma de levadura. Genes Dev. 2002, 16: 707-719. 10.1101 / gad.970902.


3. Métodos

3.1. Diseño de secuencia de ARNip específica de gen

El diseño de una secuencia de ARNip altamente eficaz y específica es el primer paso de ARNip específico para la eliminación exitosa de un gen diana. Varios grupos de Sequences han desarrollado pautas específicas para diseñar ARNip [7 & # x020139] y varias herramientas de diseño en línea están disponibles gratuitamente (por ejemplo, http://sirna.wi.mit.edu https://rnaidesigner.thermofisher.com/rnaiexpress y http://dharmacon.gelifesciences.com/design-center).

Varios fabricantes de ARNip, como Thermo Fisher Scientific, QIAGEN y GE Dharmacon, han prediseñado (y en ocasiones validadas) secuencias de ARNip para la mayoría de los genes conocidos del genoma humano. Los investigadores solo necesitan ingresar el nombre o ID del gen en línea para solicitar oligonucleótidos de ARNip específicamente diseñados para apuntar al gen de interés (ver Nota 9).

3.2. Preparación de 1. solución de ARNip

Los oligonucleótidos de ARNip comprados a proveedores comerciales (p. ej., QIAGEN y Thermo Fisher Scientific) suelen ser ARN dúplex listos para usar y no necesitan ser desalados ni recocidos. Simplemente resuspenda el polvo dúplex de ARNip liofilizado en agua sin ARNasa hasta una concentración final de 20 & # x003bcM. Sin embargo, si los oligonucleótidos de ARN vienen como ARN monocatenario, se necesita un paso de hibridación.

Para templar el ARN monocatenario, resuspenda el polvo de ARNip liofilizado recibido del proveedor en agua libre de ARNasa a una concentración final de 100 & # x003bcM. Mezcle bien la solución pipeteando hacia arriba y hacia abajo varias veces. Distribuya alícuotas de la solución en tubos nuevos en pequeños volúmenes (por ejemplo, 20 & # x003bcL) y almacénelos en & # x0221220 & # x000b0C, si no va a usarlos inmediatamente. Combine 20 & # x003bcL de cada oligonucleótido de ARNip monocatenario complementario, 20 & # x003bcL de tampón de recocido 5 & # x000d7 y 40 & # x003bcL de agua libre de ARNasa. Mezcle la solución pipeteando hacia arriba y hacia abajo varias veces. Incube la solución a 90 ° C durante 2 min y luego enfríe lentamente a temperatura ambiente colocando el tubo en un vaso de precipitados grande que contenga agua a temperatura ambiente durante aproximadamente 1 h. Centrifugue brevemente el tubo para bajar todas las gotas de los lados y la tapa del tubo. La concentración final del dúplex de ARNip recocido es 20 & # x003bcM.

Coloque alícuotas del ARNip resuspendido / recocido en tubos nuevos y almacénelos en & # x0221220 & # x000b0C. No congele-descongele la solución de ARNip más de cinco veces.

3.3. Entrega de ARNip en las células

Se han utilizado ampliamente dos métodos para administrar oligonucleótidos sintetizados químicamente en células de mamíferos: transfección y electroporación. La transfección utiliza un portador de lípidos para facilitar la captación celular de ARNip. La electroporación utiliza potentes pulsos eléctricos para generar poros hidrófilos transitorios en la membrana celular y, al hacerlo, permite la captación de macromoléculas, como los oligonucleótidos de ARNip. Aquí describo los procedimientos generales para realizar estos dos métodos (ver Nota 10).

3.3.1. Transfección con siLenFect & # x02122

Están disponibles comercialmente varios portadores de lípidos (reactivos de transfección) desarrollados específicamente para oligonucleótidos de ARNip. A menudo tienen una eficiencia de entrega diferente en diferentes tipos de células. La elección de los reactivos de transfección óptimos para el tipo de célula de interés puede requerir la comparación de reactivos de diferentes proveedores. Los protocolos de transfección varían de un reactivo a otro y, a menudo, requieren optimización para diferentes tipos de células (y, a veces, incluso diferentes líneas celulares del mismo tipo). En general, los procedimientos recomendados por el fabricante deben utilizarse como punto de partida para la optimización. Aquí, describo los procedimientos para siLenFect & # x02122 del Laboratorio BioRad como guía. Los procedimientos se basan en el manual de instrucciones proporcionado por el fabricante con algunas modificaciones.

Cultivar células MIA PaCa-2 en un matraz de cultivo de células T75 hasta una confluencia del 70 & # x0201390%. Lavar las células con 5 ml de PBS dos veces. Agregue 1 mL de solución de tripsina a las células e incube en un CO humidificado2 incubadora durante 5 min. Detenga la tripsinización agregando 10 ml de medio de crecimiento celular (RPMI-1640) que contenga FBS al 10%. Transferir las células y el medio a un tubo cónico de 15 ml y centrifugar el tubo a 200 & # x000d7 g durante 5 min para sedimentar las células. Lavar los sedimentos celulares dos veces con 5 ml de PBS y luego resuspender las células en 10 ml de medio de crecimiento que contenga suero. Cuente las células en un contador de células (por ejemplo, el Cellometer de Nexcelom Bioscience).

Semilla 0.5 a 1 & # x000d7 10 6 celdas / matraz (ver Nota 11) en 5 ml de medio de crecimiento que contiene FBS al 10% en matraces de cultivo celular T25 (ver Nota 12). Permita que las células crezcan durante la noche a 37 & # x000b0C en un 5% de CO humidificado2 incubadora.

El segundo día, 15 & # x0201360 min antes de la transfección, aspire el medio del matraz y agregue 2,5 ml de medio de crecimiento que contenga suero fresco a las células.

Para cada matraz T25 que se va a transfectar, prepare 250 & # x003bcL de solución de reactivo de transfección en un tubo Eppendorf de 1,5 ml agregando 7,5 & # x003bcL de siLenFect & # x02122 a 242,5 & # x003bcL de medio sin suero (ver Nota 13).

Para cada matraz T25 que se va a transfectar, prepare una solución de ARNip 120 nM en medio sin suero 250 & # x003bcL en un tubo Eppendorf de 1,5 ml (ver Nota 14). Esto se puede hacer primero diluyendo el siRNA stock de 20 a 1 & # x003bcM usando medio sin suero (p. Ej., 5 & # x003bcL de 20 & # x003bcM siRNA más medio 95 & # x003bcL), y luego diluyéndolo a 120 nM tomando 30 & # x003bcL del ARNip diluido (1 & # x003bcM) y agregando a 200 & # x003bcL de medio libre de células (ver Nota 15).

Agregue la solución de ARNip a la solución diluida de siLenFect & # x02122 (ver Nota 16). Mezcle golpeando ligeramente el tubo o pipeteando hacia arriba y hacia abajo. Incubar la solución mezclada durante 20 min a temperatura ambiente.

Agregue 500 & # x003bcL de los complejos siRNA / siLenfect & # x02122 a las células. Mezcle moviendo los matraces hacia adelante y hacia atrás varias veces. Incubar las células a 37 C en un 5% de CO humidificado2 incubadora.

De veinticuatro a setenta y dos horas después de la transfección, recolecte las células mediante tripsinización como se describe anteriormente (ver Nota 17) para evaluar la eficiencia de la eliminación o examinar los efectos funcionales de la eliminación de genes.

3.3.2. Entrega de ARNip mediante electroporación

Los métodos de transfección basados ​​en lípidos funcionan de manera eficiente para muchas células usando líneas de electroporación. Sin embargo, para algunas líneas celulares y tipos de células, particularmente las células primarias y las células en suspensión, estos métodos producen una baja eficiencia. Para aquellas células difíciles de transfectar, a menudo se utilizan métodos basados ​​en electroporación para administrar ácidos nucleicos. Sin embargo, la electroporación puede inducir una alta mortalidad celular y, a menudo, requiere una optimización cuidadosa de los parámetros de electroporación (voltaje, longitud del pulso eléctrico y número de pulsos) para lograr una alta eficiencia y una baja mortalidad celular.La tecnología Amaxa & # x02019s Nucleofector & # x02122 (Lonza Cologne AG) es una tecnología de electroporación avanzada que se ha utilizado ampliamente para la administración de ARNip y otros ácidos nucleicos a células difíciles de transfectar. La empresa ha desarrollado una extensa base de datos de programas y soluciones de electroporación específicos del tipo de celda, lo que ha minimizado el proceso de optimización para los usuarios finales. Aquí describo el protocolo general para usar el dispositivo y el kit Amaxa Nucleofector & # x02122 para administrar ARNip, usando células MIA PaCa-2 como ejemplo. Este protocolo es una modificación del manual proporcionado por el fabricante del kit y del dispositivo (Lonza Cologne AG).

Crecimiento de células MIA PaCa-2 en matraces de cultivo de células T75 como se describió anteriormente.

El día de la transfección, preincube las placas de 6 pocillos que contengan 1,5 ml / pocillo de medio que contenga suero a 37 ° C en un CO humidificado.2 incubadora.

Recolecte las células mediante tripsinización y cuente las células como se describe anteriormente.

Transferir las células a tubos cónicos de 15 ml (1 & # x000d7 10 6 células por tubo) y centrifugar a 100 & # x000d7 g durante 10 min a temperatura ambiente. Retire el medio por aspiración.

Resuspenda las células con cuidado en 100 & # x003bcL de Nucleofector & # x000ae a temperatura ambiente Solución V por muestra. No deje las células en la solución Nucleofector & # x000ae más de 15 min (ver Nota 18).

Agregue 1.5 & # x003bcL de ARNip (20 & # x003bcM) a la suspensión celular (para una concentración final de ARNip de 300 nM) (ver Nota 19). Mezclar pipeteando hacia arriba y hacia abajo.

Transfiera la mezcla de células / ARNip a una cubeta certificada (incluida en el kit Nucleofector & # x02122). Asegúrese de que la solución cubra el fondo de la cubeta. Cierre la cubeta con la tapa.

Inserte la cubeta que contiene la solución de células / ARNip en el portacubetas Nucleofector & # x000ae. Seleccione el programa Nucleofector & # x000ae T-020 (ver Nota 20) y aplique el programa.

Retire la cubeta del soporte una vez finalizado el programa. Añada 500 & # x003bcL del medio de cultivo preequilibrado a la cubeta. Mezcle suavemente y transfiera la solución a la placa de 6 pocillos preincubada. Utilice las pipetas suministradas con el kit y evite la aspiración repetida de las soluciones.

Incubar las células a 37 & # x000b0C en un 5% de CO humidificado2 incubadora.

Evalúe la eficiencia del derribo o examine los efectos funcionales del derribo 24 & # x0201372 h después de la electroporación.

3.4. Evaluación de la eliminación de genes mediante la reacción en cadena de la polimerasa de transcripción inversa (RT-PCR) y Western Blot

Debido a que los oligonucleótidos de ARNip se dirigen al ARNm para su degradación, la RT-PCR de eliminación de genes se puede utilizar para medir los efectos sobre la expresión génica mediante el uso de células tratadas con ARNip de control negativo inverso y células ted de transcripción de ARNsi-trea específicas de genes. Se remite a los lectores a otras publicaciones sobre los tocoles de cadena de pro-polimerasa de RT-PCR [10 & # x0201312].

Aunque la reducción en la expresión de la transcripción generalmente da como resultado una disminución de la abundancia de proteínas por transferencia Western, los niveles de ARNm no siempre se correlacionan con los niveles de proteínas. Por ejemplo, la medición del ARNm puede sobrestimar la eliminación de genes cuyos productos proteicos tienen semividas prolongadas. Por lo tanto, es necesario evaluar los niveles de proteínas para asegurar la eliminación eficiente de la expresión génica y determinar el momento óptimo para evaluar los efectos celulares de la eliminación del ARNip. Western blot es la técnica más utilizada para detectar proteínas (ver Nota 21). Los protocolos para Western Blot se pueden encontrar fácilmente en la literatura, por ejemplo, & # x0201cWestern Blotting: A guide to current methods & # x0201d (editado por Hicklin T, 2015), que se encuentra en un suplemento de Revista de ciencia.

3.5. Examen de los efectos funcionales de la caída del ARNip

Una vez que se confirma la eliminación del gen dirigido al ARNip, se pueden realizar ensayos para investigar los efectos funcionales resultantes. Dependiendo de las funciones conocidas o predichas del gen diana, se pueden usar una variedad de ensayos (crecimiento y supervivencia celular, migración, apoptosis, efectos sobre la señalización aguas abajo, etc.).


Requisitos de qPCR

Instrumentos

Muchos instrumentos de qPCR se han diseñado para admitir una gama específica de aplicaciones, por ejemplo, contrastar la capacidad del instrumento de alto rendimiento ABi 7900 que utiliza la carga automática de placas de 384 pocillos con el instrumento Eco producido y comercializado por Illumina que admite una sola placa de 48 pocillos . Por tanto, el instrumento más adecuado responde a las necesidades de la investigación. Es deseable seleccionar un instrumento con software fácil de usar que realice las funciones más deseables y tenga flexibilidad en términos de salida de datos para que pueda manipularse fácilmente en paquetes de software de análisis estadístico posteriores. Esto reduce el tiempo necesario para capacitar al personal y, por lo tanto, para comenzar a generar resultados. Las características adicionales que se requieren incluyen un bloque de PCR que es absolutamente uniforme (una desviación máxima absoluta de 1 Cq = 2 veces en 96 pozos de replicación) y un sistema óptico que excita y detecta la emisión de la manera más sensible y uniforme posible en una amplia gama de longitudes de onda. Esto permite una amplia variedad de fluoróforos y permite la multiplexación. Otras características a considerar son los costos operativos asociados con consumibles específicos, por ejemplo, si no se usa una placa de microtitulación estándar para las reacciones y también la conveniencia de cargar placas / tubos que tienen un formato no estándar.

Plantilla

Se requieren muy pocas copias del ácido nucleico diana (equivalente a aproximadamente 100 pg de ADNg o ADNc) para iniciar la qPCR. Para minimizar la contaminación con inhibidores de la reacción, la cantidad de plantilla inicial debe mantenerse al mínimo requerido para lograr una cuantificación precisa. Cuando el material de partida es ARN, el diseño del cebador y el tratamiento con ADNasa I reducirán las señales que pueden generarse a partir de la contaminación del ADNg.

Imprimaciones

Ya sea usando un tinte de unión a dsDNA o una química de detección basada en sondas, el diseño de cebadores de alta calidad es uno de los pasos pre-experimentales más críticos en qPCR. Para una discusión detallada del diseño del ensayo, PCR, qPCR, dPCR Assay Design. Para maximizar la sensibilidad y la especificidad, se deben incluir las modificaciones necesarias, como el ácido nucleico bloqueado (química de detección de qPCR).

Sonda (s)

Cuando se utilizan sondas como mecanismo de detección de amplicones, los dímeros de cebadores y los productos no específicos no se detectan, pero deben evitarse porque pueden reducir la eficacia de la reacción. Para maximizar la sensibilidad y la especificidad, se debe seleccionar el tipo de sonda apropiado para la aplicación y se deben incluir las modificaciones necesarias, como el ácido nucleico bloqueado (química de detección de qPCR).

DNTP

Las mezclas maestras de PCR y qPCR estándar contienen dATP, dCTP, dGTP y dTTP. Sin embargo, hay algunas mezclas disponibles que reemplazan dTTP con dUTP. Los productos de reacciones previas ejecutadas con dUTP contendrán uracilo en lugar de timina. Estos son entonces susceptibles de escisión por uracilo-ADN-glicosilasa (UNG). Por lo tanto, la incubación previa de reacciones posteriores con UNG evita la contaminación por arrastre entre reacciones. Para ser eficaz, todos los PCR en el laboratorio deben utilizar dUTP.

Magnesio

Cloruro de magnesio (MgCl2) es necesaria para la actividad de la transcriptasa inversa, la ADN polimerasa Taq y la exonucleasa 5 'a 3' de la ADN Taq. Las concentraciones óptimas de Mg 2+ para reacciones que contienen DLP suelen estar entre 3 y 6 mM. La mayoría de las mezclas maestras contienen MgCl2, sin embargo, a veces es necesario optimizar la concentración, por lo que un tubo adicional de MgCl puro2 normalmente se incluye con el producto de mezcla maestra (consulte Optimización y validación de ensayos). En algunos casos, una mezcla de reacción que no contiene MgCl2 puede ser necesario para que se pueda utilizar una concentración baja, por ejemplo, cuando se utiliza la detección de sonda Scorpions®.

La transcriptasa inversa

Una enzima de transcriptasa inversa que proporciona altos rendimientos de ADNc, mientras que conserva la actividad a altas temperaturas, es fundamental para el éxito de RT-qPCR. El rendimiento a altas temperaturas ayuda a garantizar que las regiones de ARN con una estructura secundaria significativa se desestabilicen y sean accesibles para la hibridación y la posterior amplificación. Al realizar RTqPCR de un solo paso, el rendimiento a alta temperatura permite el uso de cebadores específicos de genes con altas temperaturas de fusión (Tmetro), lo que aumenta la especificidad de la reacción. Al realizar protocolos de dos pasos, es importante asegurarse de que la enzima dé como resultado un rendimiento lineal y proporcional de ADNc a partir de ARN (consulte Transcripción inversa para obtener detalles de la evaluación de RT).

Taq ADN polimerasa

Al igual que con la selección de la transcriptasa inversa más apropiada para la RT, la selección de la enzima polimerasa apropiada es vital. Un problema fundamental con la ADN polimerasa Taq natural es que la enzima tiene actividad residual a baja temperatura. La unión de cebadores inespecíficos conduce a la formación de productos inespecíficos como resultado de esta actividad de polimerasa residual. Las ADN polimerasas Taq bloqueadas por anticuerpos o químicamente bloqueadas ("inicio en caliente") ayudan a rectificar esta situación al evitar la actividad enzimática hasta que comienza el paso de desnaturalización a alta temperatura.

Buffer

Tampones o mezclas maestras de reacción, por lo general contienen dNTP, una ADN polimerasa Taq, MgCl2 y estabilizadores. También se pueden incluir colorante SYBR Green I, ROX ™, fluoresceína y colorantes de carga inertes (colorantes de control de carga), según la química de detección, el instrumento y los requisitos de reacción. Los estabilizadores y los componentes del tampón de PCR suelen ser propiedad del fabricante. Si se compra por separado, es posible la máxima flexibilidad, ya que cada ingrediente se puede optimizar individualmente en la reacción. Sin embargo, por el contrario, si bien comprar los ingredientes juntos como una mezcla maestra reduce la flexibilidad, aumenta la consistencia y la conveniencia del lote al tiempo que reduce el número de pasos de pipeteo y, por lo tanto, las posibilidades de error y contaminación.

Colorantes de control de carga

Algunos termocicladores de PCR en tiempo real requieren que se incluya un colorante de carga como ROX en cada reacción para controlar la variabilidad en el sistema óptico y normalizar las diferencias en la intensidad de la señal. Asimismo, algunos termocicladores requieren una señal de fluoresceína inicial para crear un fondo virtual cuando se trabaja con ensayos de colorante SYBR Green I (que tienen un fondo muy bajo). Estos pueden suministrarse en la mezcla maestra o como componentes separados para que se pueda usar la concentración adecuada.


MATERIAL Y MÉTODOS

Biopsia por aspiración con aguja fina y cultivo celular

La PAAF se realizó utilizando una jeringa de 10 mm 3 con una aguja de calibre 23 (Cameco, Londres, Reino Unido). El primer pase se remitió a citopatología para la confirmación del diagnóstico de melanoma metastásico. Se recogió un segundo pase y se colocó en un medio de cultivo estándar y se cultivó en una placa de 24 pocillos a la concentración de 2 x 10 6 c / pocillo. Los medios de cultivo para todas las líneas celulares consistieron en RPMI 1640 (Biofluids, Rockville, MD) suplementado con tampón HEPES 10 mM, 100 U / ml de penicilina / estreptomicina (Biofluids), 10 μg / ml de ciprofloxacina (Bayer, West Haven, CT), 0.03 % De L-glutamina (biofluidos), 0,5 mg / ml de anfotericina B (biofluidos) y suero AB humano inactivado por calor al 10% (Gemini, Calabasas, CA). Las líneas celulares se desarrollaron a partir de FNA porque dicho material estaba disponible con mayor frecuencia y previamente habíamos observado una mayor tasa de éxito en el establecimiento de líneas celulares a partir de FNA que a partir de tejidos extirpados quirúrgicamente (Riker et al., 1999b).

Cultivos CTL y TIL

Se generaron cultivos de linfocitos infiltrantes de tumores (TIL) en masa (& gt95% CD8 +) a partir de melanomas metastásicos y se seleccionaron para el reconocimiento restringido por HLA-A * 0201 de células diana que expresan MART-1 y gp100. MART-127-35Se establecieron clones CD8 + específicos a partir de TIL mediante dilución limitante.

Citometría de flujo

La tinción intracelular para la expresión de la proteína gp100 y MART-1 se llevó a cabo fijando las células (10 6) en 200 µl de acetona durante 10 min a temperatura ambiente. Luego se realizó inmunofluorescencia indirecta utilizando 20 μl del MAb apropiado mediante incubación durante 45 min a 4 ° C en HBSS helado libre de Ca 2+, Mg 2+ y rojo fenol, 5% FBS inactivado por calor (biofluidos) y 0,2 % de azida sódica (tampón FACS). Se adquirieron diez mil eventos para cada análisis. La expresión superficial de HLA-A2 se analizó utilizando el MAb KS-I (proporcionado amablemente por el Dr. S. Ferrone, Buffalo, NY) como anticuerpo primario. Para el análisis de la expresión de MA, IgG murina anti-MART-1 / Melan-A2b (M2-7C10) (Marincola et al., 1996) y anti-Pmel 17 / gp-100 HMB-45 (Enzo, Farmingdale, NY) se utilizaron a diluciones de 1: 1.000 y 1:10, respectivamente. La tinción secundaria consistió en IgG anti-ratón de cabra conjugada con fluoresceína (FITC) (DAKO, Carpinteria, CA), 0,1 mg / ml. Las expresiones relativas de MA en diferentes líneas celulares se determinaron mediante inmunofluorescencia indirecta y se estandarizaron de acuerdo con la fluorescencia de un conjunto de perlas con cantidades conocidas de antígeno. Los valores de fluorescencia estandarizados se presentan como equivalente medio de fluorescencia (MEF) como se describió anteriormente (Cormier et al., 1999 ).

Reacción en cadena de la polimerasa con transcriptasa inversa (RT-PCR)

Se seleccionó un conjunto de cebadores que atraviesan intrones para amplificar cada ADNc de MA (Tabla 1a). Cada mezcla de cebadores estaba compuesta de tampón de PCR 10 ×, MgCl 1,5 mM2, DNTP 200 μM, 1,25 U de AmpliTaq Gold, 0,5 μl de ADNc y agua hasta un volumen de reacción final de 20 μl. La PCR se ejecutó utilizando el siguiente protocolo: activación inicial de la enzima a 94 ° C durante 5 min 10 ciclos de alta rigurosidad de 94 ° C durante 30 s (desnaturalización), 65 ° C durante 1 min (hibridación) y 72 ° C para 1 min (alargamiento) 20 ciclos de baja rigurosidad de 94 ° C durante 30 segundos, 60 ° C durante 1 min (excepto para tirosinasa y β-actina, 58 ° C durante 1 min) y 72 ° C durante 1 min de extensión final a 72 ° C durante 10 min. Se mezclaron seis microlitros de producto de PCR y 3 μl de tampón de carga de azul de bromofenol y se procesaron en un gel de agarosa al 1,4% durante 1 hora a 100 V. El gel se tiñó con Vistra Green (Amersham, Arlington Heights, IL) a 1: 10,000 dilución en 1 × TBE durante 50 min y se analizó en un FluoroImager 595 (Molecular Dynamics, Sunnyvale, CA). Como medida de la calidad del ADNc, se analizó el ARN de todas las líneas celulares para determinar la expresión del gen de mantenimiento endógeno β-actina. Para descartar contaminación se utilizó en todos los casos un control interno sin plantilla. La contaminación por ADN genómico de las muestras se descartó por la falta de productos de amplificación de gran peso molecular relacionados con la amplificación de secuencias genómicas por los cebadores que atraviesan intrones.

Antígeno Sentido Antisentido
gp100 5′-GCTTGGTGTCTCAAGGCAACT 5′-CTCCAGGTAAGTATGAGTGAC
MART-1 5′-ATGCCAAGAGAAGATGCTCAC 5′-AGCATGTCTCAGGTGTCTCG
Tirosinasa 5′-TTGGCAGATTGTCTGTAGCC 5′-GCTATCCCAGTAAGTGGACT
TRP-1 5′-TGTGATATCTGCACGGATGAC 5′-GTGGTTCAGGAAGACGTTGCA
TRP-2 5′-CTTAGATCTCGCGAAGAAGAG 5′-TGTGAGAAATCTATGGCCCTG
MAGE-1 5′-CCAACCCAGAGGACAGGATT 5′-CAGACTCCTCTGCTCAAGAGA
MAGE-3 5′-ACAGGCTGACCTGGAGGAC 5′-TGCTTGGAACTCGGACTCCA
ESO-1 5′-GCTTGAGTTCTACCTCGCCA 5′-AAAGCACTGCGTGATCCACAT
β-actina 5 ′ - (sentido) GGCACCACACCTTCTACAAT 5′-GCCTGGATAGCAACGTACAT

RT-PCR cuantitativa (qRT-PCR)

El ARN total de las líneas celulares de melanoma establecidas por FNAB se aisló usando RNeasy Mini Kit (Quiagen, Valencia, CA) para medir la expresión del gen MA. Se realizó una medición absoluta de la expresión génica (ABI Prism 7700 Sequence Detection System, Perkin-Elmer) utilizando RT-PCR en tiempo real (qRT-PCR) uniplex (no compensada espectralmente) (Heid et al., 1996). Cada sonda constaba de un oligonucleótido con un indicador 5 'y un colorante desactivador 3' aguas abajo. Los colorantes informadores / desactivadores se analizaron mediante análisis dual basado en los diferentes máximos de longitud de onda de emisión. Uniplex qRT-PCR se realizó utilizando diferentes tubos de reacción para el gen diana de interés y para la referencia endógena, rRNA. Cada tubo contenía una sonda Taqman que apuntaba a un solo gen de interés. Un tubo paralelo contenía la sonda específica para la referencia endógena de ARNr, marcada con un colorante indicador, 6-carboxifluoresceína (6-FAM, λmax = 518 mm) y JOE (2,7-dimetoxi-4,5-dicloro-6-carboxifluoresceína, λmax = 554 nm) desactivado con 6-carboxitetrametilrodamina (TAMRA). Cada sonda estaba flanqueada por los pares de cebadores apropiados. El ciclo de ADNc implicó la desnaturalización a 95 ° C durante 15 segundos de hibridación / extensión a 60 ° C durante 1 min para un total de 40 ciclos. La medición absoluta se realizó con una curva estándar de valores para cada objetivo de interés y para el ARNr, dividiendo la cantidad objetivo por la cantidad de referencia, con el valor final representado como el número absoluto de copias de ARNm por una cantidad seleccionada de copias de ARNr, 10 8 . Los conjuntos de cebadores y sondas marcadas utilizados para qRT-PCR se muestran en la Tabla Ib.

Antígeno Investigacion
Sentido Antisentido
gp100 6FAM-CCCATTGGTGAGAATAGCCCCCTCC-TAMRA
5′-CCCCGCATCTTCTGCTCTT 5′-ACTCAGACCTGCTGCCCACT
MART-1 6FAM-AGGCCGCTGGGATCGGCATC-TAMRA
5′-GCCACTCTTACACCACGGCT 5′-CAGTAAGACTCCCAGGATCACTGTC
Tirosinasa 6FAM-CCACTTGGGCCTCAATTTCCCTTCAC-TAMRA
5′-TGTCAGAATATCCTTCTGTCCAATG 5′-CCCGGTCATCCACCCC
TRP-1 6FAM-CCCATGATGGCAGAGATGATCGGG-TAMRA
5′-GCCCCACAGCCCTCAGT 5′-AGAAGCGCAAGGGCCAG
TRP-2 6FAM-CAGGGCCATAGATTTCTCACATCAAGGACC-TAMRA
5′-TTAGGACCAGGACGCCCC 5′-CGGTGCCAGGTAACAAATGC
MAGE-1 6FAM-CGGACAGTGATCCCGCACGCT-TAMRA
5′-TACCTGGAGTACCGGCAGGT 5′-TTGGACCCCACAGGAACTCA
MAGE-3 6FAM-CAGTTCCTTGCAGCTGGTCTTTGGCAT-TAMRA
5′-TCCTGTGATCTTCAGCAAAGCTT 5′-GGGTCCACTTCCATCAGCTC
NY-ESO-1 6FAM-CAGCTCTCCATCAGCTCCTGTCTCCAG-TAMRA
5′-TGCAGACCACCGCCAACT 5′-TCCACATCAACAGGGAAAGCT
β-actina 6FAM-AAGATCATTGCTCCTCCTGAGCGCAAGT-TAMRA
5′-CGCCCAGCACGATGAAA 5′-CCGCCGATCCACACAGAG
ARNr JOE-TGCTGGCACCAGACTTGCCCTC-TAMRA
5′-CGGCTACGACATCCAAGGAA 5′-GCTGGAATTACCGCGGCT

Ensayos funcionales

Para los ensayos funcionales, se cocultivaron 1 x 10 5 células efectoras con 5 x 10 4 células diana en placas de fondo redondo de 96 pocillos en 200 μl de medio de cultivo. Después de 24 horas de incubación a 37 ° C, se analizó la concentración de citocinas en los sobrenadantes mediante ELISA (Endogen, Cambridge, MA). Los valores de IFN-γ y GM-CSF reflejan la cantidad (pg / ml) secretada por 1 x 105 células efectoras en 24 h. El ensayo de citotoxicidad fluorescente de calceína-AM se realizó incubando 106 células diana / pocillo con 15 μl de calceína-AM (Molecular Probes, Eugene, OR) para el marcaje fluorescente como se describió anteriormente (Roden et al., 1999). Después de 30 min, todas las dianas se lavaron 3 veces con medio de cultivo y se sembraron por triplicado en placas de fondo plano de 96 pocillos a 3.000 células diana / 100 μl. Las células efectoras se recogieron y se añadieron a las células diana en relaciones E: T de 10: 1, 5: 1 y 2,5: 1 en 100 µl de medio. Después de 4 horas a 37 ° C, se agregaron 5 μl de FluoroQuench (One Lambda, Canoga Park, CA) a cada pocillo para extinguir la fluorescencia de fondo, y las placas se escanearon en un FluorImager 595 (Molecular Dynamics, Sunnyvale, CA). La fluorescencia se cuantificó utilizando el software ImageQuant (Molecular Dynamics).La lisis se calculó usando la siguiente fórmula: (1 - [fluorescencia experimental - fluorescencia de fondo] / [solo fluorescencia diana - fluorescencia de fondo]) × 100. Los valores finales son representativos de 3 experimentos separados.

Análisis estadístico

Se usó la prueba de suma de rangos de Wilcoxon para correlacionar los valores de liberación o lisis de citocinas para diferentes líneas celulares con los niveles de su expresión de ARNm. Se evaluaron los coeficientes de correlación de rango de Spearman con el fin de determinar si existía una asociación entre el número de copias de ARNm y el reconocimiento de CTL determinado por los ensayos de liberación de citocinas de IFN-γ y GM-CSF. Las correlaciones con un valor r de & gt0.7 se interpretaron como fuertes, de 0.5 a 0.7 como moderadas y aquellas por debajo de 0.5 en magnitud absoluta se consideraron débiles. Todos pag Los valores son de dos colas y no se han ajustado para el número de parámetros examinados, ya que cada uno se considera un parámetro importante por derecho propio.


Materiales y métodos

Cultivos celulares y muestras de tejidos

ZR-75-1 (ATCC número CRL-1500) es una línea celular de cáncer de mama originalmente aislada de un sitio metastásico de una mujer de 63 años. Las células se cultivaron en RPMI que contenía suero de ternero fetal al 10% (Sigma) a 37 ° C en CO al 5%2.

Se proporcionaron muestras de tumores del Tumorbank Bern (Suiza) siguiendo las directrices del Comité de Ética de Berna. Las muestras frescas se sumergieron en RNAlater (Qiagen) o se procesaron para evaluación histológica mediante FFPE estándar. La fijación se realizó en paraformaldehído al 4% en PBS. Se utilizó formalina tamponada para evitar la acidificación del tejido durante la fijación.

Extracción de ARN y degradación química

Las células cultivadas se recolectaron en PBS, se lavaron y se resuspendieron en tampón de extracción de ARN (RLT) y se homogeneizaron con una politrona. El ARN se extrajo mediante unión selectiva a una membrana basada en gel de sílice (RNeasy, Qiagen). Cuatro 25 μSe prepararon secciones de m de espesor a partir de una muestra tumoral conservada con ARN posterior a -30 ° C, se homogeneizaron en RLT con una politrona y se extrajo el ARN de acuerdo con el protocolo RNeasy (Qiagen). Se utilizó un protocolo diferente para preparar ARN a partir de muestras FFPE: diez 20 μSe desparafinaron secciones de m de espesor extrayendo dos veces en xileno durante 20 min a 37ºC y se deshidrataron en etanol sin ARNasa al 99% y se secaron al aire. Las secciones se lisaron en 650 μl solución de lisis de ARN 2 × Nc caotrópica, (Applied Biosystems, Foster City, CA, EE. UU.) y digerida durante 12-16 ha 55 ° C en presencia de 500 μg de proteinasa K.12, 13, 20 Se purificó ARN en una estación de preparación de ácidos nucleicos ABI PRISM ™ 6100 (Applied Biosystems) y se recogió en 100 μl agua o solución de elución. El ARN se cuantificó espectroscópicamente (NanoDrop, Witec, Suiza) y la calidad se evaluó mediante electroforesis capilar (Agilent 2100 Bioanalyzer, Agilent Technologies, Palo Alto, CA, EE. UU.).

El ARN de ZR-75-1 se hidrolizó parcialmente mediante incubación en una solución de NaHCO 0,5 M3/N / A2CO3 tampón (pH = 10) durante 1,5–120 min a 60 ° C, como se indica en las figuras. La hidrólisis del ARN se detuvo mediante la adición de NaAc 3 M pH 5,2 y la precipitación con etanol (100%). La degradación del ARN se evaluó mediante electroforesis capilar utilizando un bioanalizador y una escalera de ARN 6000 como ARN de referencia (Ambion, Nr. 7152).

Diseño de cebador / sonda para PCR de ensayo TaqMan

Las secuencias de nucleótidos y los límites exón-intrón de GAPDH (hCG2005673), IGFBP5 (hCG16384), ARNm de ERBB2 (hCG28177) y ARN ribosómico 18S (X03205) se obtuvieron de la plataforma en línea Celera Discovery Systems ™ (https: //myscience.appliedbiosystems. com) o NCBI (http://www3.ncbi.nlm.nih.gov/). El cebador y las sondas se diseñaron con el software Primer Express® v. 2.0 (Applied Biosystems, Foster City, CA, EE. UU.). Las sondas se marcaron con 6-FAM ™ en el extremo 5 'y con un extintor de MGB no fluorescente en el extremo 3'. El cebador directo y la sonda para cada gen se combinaron con dos o tres cebadores inversos diferentes que dieron como resultado amplicones cortos (54-65 pb), amplicones de tamaño mediano (83-111 pb) y amplicones largos (103-147 pb) (Tabla 1 ). Los cebadores y las sondas eran de Applied Biosystems (Warrington, Reino Unido).

Análisis de expresión y transcripción inversa

La transcripción inversa de ARN derivado de FFPE y material posterior de ARN se realizó a partir de 250 ng de ARN total y 125 U de transcriptasa inversa Multiscribe ™ (High-Capacity cDNA Archive Kit, Applied Biosystems, Foster City, CA, EE. UU.). Se sintetizó ADNc primario aleatorio a partir de ARN ZR-75-1 intacto e hidrolizado con transcriptasa inversa AMV, siguiendo el protocolo del fabricante (Roche diagnostics). La expresión se midió a partir de 5 ng de ADNc por reacción con conjuntos de sondas de cebadores que representan amplicones cortos, medianos y largos (Tabla 1). También se llevó a cabo una PCR en tiempo real a partir de ARN que no se transcribió de forma inversa (sin control de RT). A continuación, cada ADNc se analizó en matrices de baja densidad TaqMan® (Applied Biosystems). Estas matrices son tarjetas prefabricadas de 384 pocillos, donde cada pocillo se identifica con cebadores y sondas específicos de genes durante la fabricación. Se utilizaron matrices con cuatro conjuntos de 96 genes. Cada reacción se lleva a cabo con 0,5 a 1 ng de mRNA / cDNA por pocillo en un volumen final de 1 μl. Los conjuntos de cebadores / sondas se eligieron de la gran colección de ensayos de expresión génica TaqMan®, con conjuntos de cebadores y sondas optimizados (Applied Biosystems, Foster City, CA, EE. UU.). Cuando fue posible, se eligieron ensayos de expresión génica TaqMan con sondas que abarcan los límites exón-exón para minimizar las señales del ADN cromosómico contaminante. La lista de ensayos se proporciona en la Tabla 2. Los ADNc se mezclaron con 2 × TaqMan® Universal Mastermix (Applied Biosystems) y 100 μMe cargaron en cada puerto de llenado de las matrices de baja densidad. En total, 48 pozos de la matriz están conectados a un puerto de llenado a través de microcanales. Los ADNc se distribuyen en los pocillos mediante una breve centrifugación. Los canales se sellaron según lo recomendado por el fabricante y la QRT-PCR se realizó en un instrumento Applied Biosystems 7900HT.

Normalización de datos

Los valores de ciclo de umbral absoluto (valores Ct) se determinaron con el software SDS v. 2.1 (Applied Biosystems). Los datos de expresión de 15 genes de control putativos se incluyeron en cada conjunto de 96 genes. Los genes de control que tenían la variación más baja entre los 15 tumores se identificaron con GeNorm, un software que se desarrolló para determinar los genes de control óptimos de una lista más grande de genes de control putativos, que mostró la variación más baja entre los tumores en todos los tumores. 21

Inmunohistoquímica

La inmunohistoquímica se llevó a cabo de acuerdo con protocolos estándar y esencialmente como se describió anteriormente. 22


Resultados

Los protocolos que desarrollamos tenían como objetivo aislar una sola célula gigante cerebral con precisión y rapidez del Lymnaea CNS y luego para determinar el número exacto de copias de ARNm de CREB, cada uno de los cuales se comparó con una curva estándar preparada a partir de soluciones de ADNc correspondientes a las soluciones diluidas en serie de Lymnaea ARNm de CREB. Como resultado, nuestro sistema de ensayo mostró que el número de copias de ARNm de CREB2 era 30-240 en una sola célula gigante cerebral, mientras que el de ARNm de CREB1 estaba por debajo de la sensibilidad de determinación.

Aislamiento rápido y preciso de una única neurona identificable

Los micromanipuladores recientemente desarrollados con microelectrodos de vidrio, que se fabricaron con una punta redonda y tapada fundida al fuego (California. 10 μm de diámetro), se utilizaron para el aislamiento de una única célula gigante cerebral bajo un microscopio estereoscópico. Como se mencionó anteriormente, también se aisló una pequeña longitud de neurita primaria de la célula gigante cerebral (Fig. 1). Nuestro procedimiento nos permitió aislar un solo gigante cerebral del SNC en 20 min. Este período es mucho más corto que el del uso de una pipeta de parche o microdisección láser (Monyer y Lambolez, 1995 Surmeier et al., 1996 Baro et al., 1997 Schütze et al., 1997 Fink et al., 1998 Tkatch et al. , 2000 Liss et al., 2001 Tsuzuki et al., 2001 Liss, 2002 Song, 2002 Mawrin et al., 2003).

La morfología de las células gigantes cerebrales aisladas se observó bajo un microscopio estereoscópico para confirmar que los somas estaban intactos y que no había otras células unidas a las neuronas diana. Para confirmar aún más que aislamos solo una única célula gigante cerebral sin otras células, la neurona aislada se fijó y se tiñó con Hoechst33258, seguido de observación con un microscopio de fluorescencia. Solo se observó el núcleo de la célula gigante cerebral, lo que confirma que no se extrajeron otras células con la única célula gigante cerebral (Fig. 1). Por lo tanto, consideramos que los ARN en los somas de neuronas aisladas se mantuvieron completamente y que ningún ARN estaba contaminado por otras neuronas o células gliales.

Validez del ensayo qRT-PCR para la determinación del número de copias de ARNm en una sola neurona incluso en presencia de restos celulares

Cuando se utiliza el método qRT-PCR para una célula completa, las soluciones de muestra incluyen restos celulares, como ADN del genoma, proteínas, lípidos, etc. En comparación, las soluciones de ARN estándar son puras, ya que se sintetizan a partir de las plantillas de ADNc. En consecuencia, debemos confirmar la eficacia de la RT-PCR para una muestra de solución de ARNm que contiene restos celulares.

Primero obtuvimos la curva estándar de las soluciones de ARN de CREB2, y luego obtuvimos la curva para las soluciones de muestra de ARNm de CREB2 que se prepararon a partir de 19 células cerebrales gigantes. La curva estándar era lineal dentro del rango de 2 x 10 a 1 x 10 5 copias, y la curva de ARNm de la muestra era paralela a la curva estándar en 10 a 3 x 10 2 copias (Fig. 2). Las pendientes de las líneas fueron –3,98 para las soluciones estándar y –3,94 para las soluciones de muestra. Estos resultados mostraron que el ARN se puede amplificar con la misma eficacia tanto en soluciones de ARN estándar como en soluciones de ARNm de muestra mediante qRT-PCR.

Estabilidad del ARN durante los procedimientos.

También era importante comprobar la degradación del ARNm diana causada por la ARNasa endógena en neuronas aisladas o por el procedimiento de congelación-descongelación. Para examinar este problema, determinamos el número de copias de ARN sintetizado de GTH α2 de salmón que se agregó a la solución de lisis con una neurona aislada (Fig. 3). El número de copias de ARN GTH α2 de salmón en 1 μl de una solución de muestra (1/15 volumen de productos transcritos de forma inversa) fue 4143 ± 71 (norte= 20 de duplicados de 10 muestras, Fig. 3C). Por lo tanto, la variación intraensayo de nuestro sistema de ensayo qRT-PCR está dentro del 15%, cuando el número de copias varía de decenas a miles.

Evaluación del ensayo de qRT-PCR mediante una comparación de las eficiencias de RT-PCR entre soluciones de ARN estándar y soluciones de ARNm de muestra que contienen restos celulares. Los círculos sólidos muestran la relación entre la cantidad inicial de ARN y los ciclos de umbral para el estándar. Lymnaea Soluciones de ARN CREB2. La pendiente de la recta de regresión es –3,98. Los círculos abiertos muestran la relación entre la cantidad inicial de ARNm y los ciclos de umbral para el Lymnaea Muestras de ARNm de CREB2 obtenidas de las células gigantes cerebrales. A la cantidad de ARNm total en la muestra, cuando se usaron 19 células en un tubo, se le asignó arbitrariamente un valor de uno. La pendiente de la recta de regresión es –3,94. Las dos pendientes paralelas confirmaron que los ARN de las soluciones y muestras de ARN estándar podrían amplificarse con la misma eficacia de RT-PCR en qRT-PCR.

Evaluación del ensayo de qRT-PCR mediante una comparación de las eficiencias de RT-PCR entre soluciones de ARN estándar y soluciones de ARNm de muestra que contienen restos celulares. Los círculos sólidos muestran la relación entre la cantidad inicial de ARN y los ciclos de umbral para el estándar. Lymnaea Soluciones de ARN CREB2. La pendiente de la recta de regresión es –3,98. Los círculos abiertos muestran la relación entre la cantidad inicial de ARNm y los ciclos de umbral para el Lymnaea Muestras de ARNm de CREB2 obtenidas de las células gigantes cerebrales. A la cantidad de ARNm total en la muestra, cuando se usaron 19 células en un tubo, se le asignó arbitrariamente un valor de uno. La pendiente de la recta de regresión es –3,94. Las dos pendientes paralelas confirmaron que los ARN de las soluciones y muestras de ARN estándar podrían amplificarse con la misma eficacia de RT-PCR en qRT-PCR.

Además, diluimos el ARN GTH α2 de salmón de 100.000 copias (1,1 / 10, 1/100, 1/1000, 1/10000, 1/100000) y teóricamente obtuvimos 1 copia (Fig. 3D). El error en 10 copias, es decir 1/10000, muestra que el s.e.m. es lo suficientemente bajo (2,93, norte= 6 muestras). Estos resultados indicaron que podemos ignorar la degradación del ARNm diana por la ARNasa endógena en las células gigantes cerebrales aisladas o por el procedimiento de congelación-descongelación.

Determinación del número de copias de Lymnaea ARNm de CREB2 en una sola célula gigante cerebral

Determinamos el número de copias de Lymnaea ARNm de CREB2 en una sola célula gigante cerebral (Fig. 4A, B). En 6 μl de la solución de muestra (por duplicado de 15 μl de solución para una sola neurona), se determinó que el número de copias oscilaba entre 10 y 180 mediante los siguientes procedimientos. El umbral se estableció bajo la condición de que las amplificaciones por PCR para todas las muestras de neuronas individuales mostraran patrones exponenciales (Fig. 4A). A continuación, los ciclos de umbral se exportaron a la curva estándar preparada con las soluciones estándar de ARN (Fig. 4B). El número de copias de 10-180 obtenido a partir de la determinación del ARNm de CREB2 (norte= 11 celdas individuales) se incluyó en la región paralela a la curva estándar, como se muestra en la Fig. 2. Por lo tanto, el número de copias obtenido aquí se consideró confiable. Al calcular el valor promedio de muestras duplicadas para cada neurona, se estimó que el número de copias de ARNm de CREB2 en una sola célula gigante cerebral estaba entre 30 y 240.

Determinación del número de copias de Lymnaea ARNm de CREB1 en una sola célula gigante cerebral

A continuación, determinamos el número de copias de Lymnaea ARNm de CREB1 en una sola célula gigante cerebral (Fig. 4C, D). En 6 μl de la solución de muestra (por duplicado de la solución de 15 μl para una sola neurona), el número de copias fue inferior a 10 (norte= 31 celdas individuales, Fig. 4D). Un número de copias tan pequeño estaba por debajo del rango de detección de nuestro sistema de ensayo, porque menos de 10 copias de ARN estándar es un número demasiado pequeño para mostrar una amplificación reproducible. El s.e.m. calculado a partir de tres experimentos para obtener la curva estándar fue 0,47 para 10 copias, 0,98 para cinco copias y 3,77 para una copia. Por lo tanto, aunque no podemos verificar el número exacto de copias de Lymnaea ARNm de CREB1 en una sola célula gigante cerebral, podemos confirmar que el número es pequeño.

Efectos del tratamiento enzimático sobre el número de copias de Lymnaea ARNm de CREB2

Se requiere un tratamiento con enzimas para desempañar el SNC y aislar rápidamente una sola neurona. Por lo tanto, examinamos los efectos del tratamiento enzimático sobre el número de copias del ARNm diana. ARN totales de los SNC de control y los de los SNC tratados con 2 mg ml -1 de tripsina durante 10 min o 2 mg ml -1 de proteasa tipo IX durante 10 min en el Lymnaease purificó la solución salina y se sometieron a transcripción inversa 120 ng de ARN total de cada grupo. Entonces, el número de copia de Lymnaea El cDNA de CREB2 se determinó mediante qRT-PCR. No se observaron diferencias significativas entre el control y la muestra tratada con tripsina o entre el control y la muestra con proteasa (control, N =8, 102498 ± 7065 tripsina, N =5, 110202 ± 9312 proteasa tipo IX, norte= 10,123005 ± 10296). Estos resultados indican que el uso de enzimas es factible para la disección de muestras del SNC.

Evaluación del ensayo qRT-PCR mediante la determinación del número de copias de ARN exógeno a una concentración conocida en las soluciones de reacción. (A) Gráficos de amplificación generados por el aumento de la fluorescencia del colorante indicador con cada ciclo de PCR de ADNc de GTH α2 de salmón. Los recuadros sólidos muestran soluciones estándar y los recuadros abiertos muestran las muestras de prueba. Todas las reacciones se realizaron por duplicado (1 μl cada una, que era 1/15 del volumen total de los productos transcritos de forma inversa). Se obtuvo un ciclo de umbral arbitrario en la fase exponencial de la PCR. (B) Curva estándar para la cantidad inicial de ARN GTH α2 de salmón. Los círculos sólidos muestran soluciones estándar y los círculos abiertos las muestras de prueba. (C) Copie números de ARN de GTH α2 de salmón en muestras de 1 l (1/15 del volumen total del producto de transcripción inversa). El volumen total para la transcripción inversa fue de 15 μl con 6 × 10 4 copias de ARN y, por lo tanto, el valor detectado de 4143 ± 71 copias (norte= 20 de los duplicados de 10 muestras) en 1 μl de solución (es decir, 1/15 del volumen de los productos con transcripción inversa) era razonable. (D) Dilución en serie de ARN GTH α2 de salmón. El error en 10 copias muestra que el s.e.m. es lo suficientemente bajo (2,93, norte= 6 muestras).

Evaluación del ensayo qRT-PCR mediante la determinación del número de copias de ARN exógeno a una concentración conocida en las soluciones de reacción. (A) Gráficos de amplificación generados por el aumento de la fluorescencia del colorante indicador con cada ciclo de PCR de ADNc de GTH α2 de salmón. Los recuadros sólidos muestran soluciones estándar y los recuadros abiertos muestran las muestras de prueba. Todas las reacciones se realizaron por duplicado (1 μl cada una, que era 1/15 del volumen total de los productos transcritos de forma inversa). Se obtuvo un ciclo de umbral arbitrario en la fase exponencial de la PCR. (B) Curva estándar para la cantidad inicial de ARN GTH α2 de salmón. Los círculos sólidos muestran soluciones estándar y los círculos abiertos las muestras de prueba. (C) Copie números de ARN de GTH α2 de salmón en muestras de 1 l (1/15 del volumen total del producto de transcripción inversa). El volumen total para la transcripción inversa fue de 15 μl con 6 × 10 4 copias de ARN y, por lo tanto, el valor detectado de 4143 ± 71 copias (norte= 20 de los duplicados de 10 muestras) en 1 μl de solución (es decir, 1/15 del volumen de los productos con transcripción inversa) era razonable. (D) Dilución en serie de ARN GTH α2 de salmón. El error en 10 copias muestra que el s.e.m. es lo suficientemente bajo (2,93, norte= 6 muestras).

Los números de copia de Lymnaea ARNm de CREB2 y CREB1 en células gigantes cerebrales individuales. (A) Gráficos de amplificación generados por un aumento de la fluorescencia del tinte indicador con cada ciclo de PCR de Lymnaea ADNc de CREB2. Los cuadrados rellenos muestran soluciones estándar y los cuadrados abiertos muestran las muestras de prueba. Todas las reacciones se realizaron por duplicado (6 µl cada una, que era 6/15 del volumen total de los productos transcritos de forma inversa). Se obtuvo un ciclo de umbral arbitrario en la fase exponencial de la PCR. (B) Curva estándar para la cantidad inicial de Lymnaea ARN CREB2. Los círculos rellenos muestran soluciones estándar y los círculos abiertos las muestras de prueba. El número de copias estimado de Lymnaea El ARNm de CREB2 en una sola célula gigante cerebral estaba entre 30 y 240. (C) Gráficos de amplificación generados por un aumento de la fluorescencia del colorante indicador con cada ciclo de PCR de Lymnaea ADNc de CREB1. La notación es la misma que (A). (D) Curva estándar para la cantidad inicial de Lymnaea ARN CREB1. La notación es la misma que (B). El número de copias estimado de Lymnaea El ARNm de CREB1 en una sola célula gigante cerebral estaba por debajo de la sensibilidad de determinación.

Los números de copia de Lymnaea ARNm de CREB2 y CREB1 en células gigantes cerebrales individuales. (A) Gráficos de amplificación generados por un aumento de la fluorescencia del tinte indicador con cada ciclo de PCR de Lymnaea ADNc de CREB2. Los cuadrados rellenos muestran soluciones estándar y los cuadrados abiertos muestran las muestras de prueba. Todas las reacciones se realizaron por duplicado (6 µl cada una, que era 6/15 del volumen total de los productos transcritos de forma inversa). Se obtuvo un ciclo de umbral arbitrario en la fase exponencial de la PCR. (B) Curva estándar para la cantidad inicial de Lymnaea ARN CREB2. Los círculos rellenos muestran soluciones estándar y los círculos abiertos las muestras de prueba. El número de copias estimado de Lymnaea El ARNm de CREB2 en una sola célula gigante cerebral estaba entre 30 y 240. (C) Gráficos de amplificación generados por un aumento de la fluorescencia del colorante indicador con cada ciclo de PCR de Lymnaea ADNc de CREB1. La notación es la misma que (A). (D) Curva estándar para la cantidad inicial de Lymnaea ARN CREB1. La notación es la misma que (B). El número de copias estimado de Lymnaea El ARNm de CREB1 en una sola célula gigante cerebral estaba por debajo de la sensibilidad de determinación.


MÉTODOS

Muestras de tejido

Las autopsias cerebrales fueron proporcionadas por el Stanley Foundation Brain Consortium (Maryland, EE. UU.), Por el Maudsley Brain Bank (Instituto de Psiquiatría, Departamento de Neuropatología, Londres, Reino Unido) y por el Harvard Brain Tissue Resource Center (Massachusetts General Hospital, Massachusetts). , ESTADOS UNIDOS). Cada muestra de autopsia se proporcionó por triplicado, que se tomaron de tres segmentos adyacentes de la corteza frontal (giro frontal). Se utilizaron ochenta y una autopsias obtenidas de veintisiete individuos para análisis de sexo, tiempo post mortem y diferencias de edad, así como para cálculos de potencia. Todas las muestras utilizadas fueron de individuos sin ningún diagnóstico psiquiátrico.

Para el análisis de biopsias versus autopsias se utilizaron 39 autopsias obtenidas de 13 individuos y biopsias obtenidas de 14 individuos. Las biopsias se prepararon por triplicado después del paso de Trizol (ver métodos a continuación) para producir 42 muestras. Las biopsias obtenidas de tejido cerebral cortical de pacientes con epilepsia o tumores cerebrales se donaron al hospital Addenbrookes (Cambridge, Reino Unido). Se diseccionó un cubo de & # x0223c & # x020093 mm en cada lado de cada biopsia y se preparó el ARN como se describe a continuación. Las muestras se codificaron y se ocultó a los investigadores la información sobre el sexo, la edad y el estado de la enfermedad de cada paciente para garantizar la confidencialidad. Por esta razón, el material de biopsia solo se utilizó para las comparaciones de los niveles de expresión de la biopsia y la autopsia. El resto de los análisis se realizaron únicamente con material de autopsia. Todos los tejidos se almacenaron a & # x0201370 & # x000b0C antes de su uso.

Preparación de muestras de tejido

Homogeneizamos 50 & # x02013100 mg de tejido cerebral post mortem en 2 ml de reactivo Trizol (Life Technologies, Suecia) usando un homogeneizador básico Ultra-Turrax T25 (Ika Labortecnhik, Alemania). Las muestras homogeneizadas se almacenaron a & # x02212 & # x0200970 & # x000b0C antes de su uso.

Preparación de ARN total y purificación de PolyA & # x0002b RNA & # x02009

El ARN total se preparó a partir de los homogeneizados de tejido de acuerdo con las instrucciones del fabricante para el aislamiento de ARN utilizando el reactivo Trizol (Life Technologies, Suecia) con estas modificaciones menores: el sedimento de ARN producido se lavó con 1 ml de etanol 70 & # x00025 en lugar de etanol 75 & # x00025 y el sedimento de ARN se secó al vacío durante 1 & # x020132 min antes de que se disolviera en 20 & # x003bcL de agua libre de ARNasa y se incubó durante 10 min a 60 & # x000b0C en un baño de agua. La pureza y la calidad del ARN total se ensayaron en un gel de agarosa 1 & # x00025 y se calculó la recuperación después de medir la absorbancia con un espectrofotómetro a 260 nm. A continuación, las muestras se almacenaron a & # x02212 & # x0200970 & # x000b0C antes de su uso posterior. Se extrajo ARN PolyA & # x0002b de la preparación de ARN total mediante una modificación del sistema de aislamiento de ARNm PolyATtract IV (Promega SDS, Suecia). El material de partida fue 10 & # x003 bcg de ARN total y usamos diez veces menos que las cantidades de reactivo recomendadas en todos los pasos. El volumen final de ARNm fue de 25 & # x003bcL y las muestras se almacenaron a & # x02212 & # x0200970 & # x000b0C.

Transcripción inversa

Se prepararon dos tipos de placas de réplica de 96 pocillos con 2 & # x003bcL u 8 & # x003bcL PolyA & # x0002b ARN por pocillo, una placa que contiene 81 muestras de autopsia y otra que contiene 42 muestras de autopsia, así como 39 muestras de biopsia. A los pocillos, se añadieron 2 & # x003bcL de oligo (dT) y agua libre de ARNasa hasta un volumen total de 10 & # x003bcL. La placa se incubó durante 2 min a 90 ° C en un PTC 225 (MJ Research SDS). Durante este tiempo, la sonda de oligo (dT) se hibridaba con el ARNm. Después del paso de recocido, se añadió la mezcla maestra de transcriptasa. La mezcla maestra de transcriptasa para cada muestra contenía 4 & # x003bcL tampón de primera hebra, 2 & # x003bcL DTT, 0,5 & # x003bcL dNTP (10 mM), 1,5 & # x003bcL agua, 1 & # x003bcL Superscript II (Life Technologies, Suecia) . Las muestras se incubaron en el mismo PTC 225, durante 1 hora a 42 ° C. Después de la transcripción inversa, todas las muestras se diluyeron 1: 8 con agua estéril. En la placa de RT, que ahora contiene ADNc diluido, había un estándar, varios controles de amplificación negativa (NAC) que contenían poliA & # x0002b, y todos los reactivos excepto la transcriptasa inversa. La curva estándar se preparó a partir de ADN genómico humano con una concentración de 10 ng / & # x003bcL, 1 ng / & # x003bcL, 0,1 ng / & # x003bcL y 0,01 ng / & # x003bcL equivalentes a 11.000, 1100, 110 y 11 copias del genoma humano. NAC funcionó como un control de fondo y contenía cDNA y todos los reactivos excepto Superscript II. Se usó un segundo control negativo, el control de plantilla negativo (NTC), en la reacción de TaqMan. Este control no contenía ADN, pero todos los reactivos de TaqMan. Después de agregar el estándar y los controles negativos a la placa de RT, el contenido de la placa se dividió en alícuotas en 40 placas ópticas TaqMan, produciendo placas de réplica para usar en el ensayo TaqMan más adelante. Cada placa de réplica contiene & # x0223c & # x0200910 & # x02013100 ng de ADNc por pocillo, y se utiliza una placa de réplica para analizar cada gen. Finalmente, todas las placas se secaron en un horno a 42 ° C durante un tiempo y luego se almacenaron a 4 ° C antes de su uso.

La nucleasa fluorogénica 5 & # x02032 & # x02009

A cada pocillo de ADNc de la placa óptica TaqMan, se le añadieron 25 & # x003bcL TaqMan master mix. Cada muestra de la mezcla maestra TaqMan consistió en 12.6 & # x003bcL de agua estéril, 2.5 & # x003bcL de tampón TaqMan 10X, 6.0 & # x003bcL MgCl2, 2.0 & # x003bcL dNTP (5 mM de dUTP y 2.5 mM de dATP, dGTP y dCTP), 0.5 & # x003bcL Primer forward (10 & # x003bcM), 0.5 & # x003bcL Primer reverse (10 & # x003bcM), 0.5 & # x003bcL sonda (5 & # x003bcM), 0,25 & # x003bcL uracil-N-glicosilasa (UNG) y 0,125 & # x003bcL Taq gold (kit de reactivos de núcleo de PCR TaqMan, Perkin Elmer). El perfil de amplificación en el detector de secuencia ABI Prism 7700 (Perkin Elmer) fue el siguiente: 2 min a 50 & # x000b0C, 10 min a 95 & # x000b0C, seguido de 40 ciclos de 15 segundos a 95 & # x000b0C y 1 min a 60 & # x000b0C. Se utilizó el software Primer Express (Perkin-Elmer Applied Biosystems) para diseñar cebadores y sondas. Los cebadores se adquirieron de Perkin Elmer o Interactiva y las sondas de Perkin Elmer. Las secuencias de los 48 cebadores que pueden usarse para medir la expresión de los 16 genes discutidos en este manuscrito están disponibles en nuestro sitio web (ver http://www.genpat.uu.se/psge/psgecastensson.html). Los datos de expresión producidos fueron analizados y convertidos en valores de ciclo umbral (valores Ct) por el detector de secuencia 1.6.3. sistema de software. Los valores de Ct se calcularon a partir de un gráfico de amplificación, que da el ciclo en el que cada amplificación por PCR alcanza una desviación estándar significativa del umbral. Cuanto mayor sea la concentración objetivo, menor será el número de ciclos de amplificación necesarios para detectar el aumento en la emisión del indicador. A continuación, los valores de Ct se tradujeron en número de copias utilizando la curva estándar.

Análisis estadístico

Para determinar las diferencias de expresión entre sexos, tiempo post mortem e individuos, se utilizó el software Statistica de Statsoft para el análisis ANCOVA. En general, el propósito del análisis de varianza (ANOVA) es probar las diferencias significativas entre las medias. Un análisis de covarianza (ANCOVA) es un tipo de análisis ANOVA que se utiliza para comparar las medias entre dos o más grupos de sujetos mientras se controlan las variables de confusión (covariables) que podrían influir en la respuesta de la variable dependiente. Las medias de grupo comparadas en ANCOVA se ajustan con las medias de grupo para las covariables (Gaddis 1998, Lee 1987, Statsoft 1999). Este análisis reduce gran parte de la variabilidad entre muestras debido a las diferentes cantidades de ARN en cada muestra.

Debido a la gran variabilidad en la calidad de las muestras de tejido post mortem, primero estudiamos la correlación lineal entre un gen de prueba (variable) y múltiples genes de referencia (covariables). Utilizamos el análisis ANCOVA para comparar las medias ajustadas de dos grupos de muestras. Todos los datos de expresión utilizados en nuestro análisis estaban sesgados y, por lo tanto, requerían una transformación logarítmica antes del análisis. Uno de los supuestos de ANOVA es tener una muestra distribuida normalmente. Por lo tanto, utilizamos el logaritmo del número medido de copias de ADNc amplificadas en todos los análisis. La hipótesis nula en el análisis ANCOVA es que no hay diferencia significativa entre los grupos comparados. La hipótesis nula se acepta o rechaza dependiendo de si existe o no una diferencia significativa entre las medias ajustadas. Realizamos & # x0223c & # x02009100 pruebas estadísticas independientes y, por lo tanto, aceptamos una corrección de Bonferroni. PAG-valor de & # x022dc & # x020090.0005 como significativo (Zhang et al. 1997). Los cálculos de potencia se realizaron utilizando el paquete de software Power XXA de Statsoft. Usamos las medias ajustadas para cada individuo obtenidas después del análisis ANCOVA para calcular la media ajustada y la desviación estándar del conjunto de datos completo para cada gen. Estos parámetros se usaron luego para determinar el tamaño de muestra requerido para cada gen usando el paquete Power XXA.

EXPRESIONES DE GRATITUD

Las muestras de cerebro postmortem fueron donadas por el Stanley Foundation Brain Consortium (Maryland, EE. UU.), Cortesía de Llewellyn B. Bigelow, Juraj Cervenak, Mary M. Herman, Thomas M. Hyde, Joel E. Kleinman, Jos & # x000e9 D. Palt & # x000e1n, Robert M. Post, E. Fuller Torrey, Maree J. Webster y Robert H. Yolken por el Maudsley Brain Bank, Instituto de Psiquiatría, Departamento de Neuropatología, Londres, Reino Unido por el Harvard Brain Tissue Resource Center, Massachusetts General Hospital, Massachusetts, Estados Unidos. Las biopsias se donaron al hospital Addenbrookes, Cambridge, Reino Unido. Agradecemos al Dr. Ulf Pettersson y al Dr. Ulf Landegren por leer y discutir el manuscrito. Agradecemos a Brian Bond, Smith Kline Beecham, por su asesoramiento estadístico. Las subvenciones del Consejo Sueco de Investigación Médica, la Fundación G & # x000f6ran Gustafssons y la Fundación Beijer apoyaron este trabajo.

Los costos de publicación de este artículo se sufragaron en parte mediante el pago de cargos por página. Por lo tanto, este artículo debe estar marcado como & # x0201cadvertisement & # x0201d de acuerdo con la sección 1734 de 18 USC únicamente para indicar este hecho.



Comentarios:

  1. Tojagul

    Esto es realmente una farsa, una especie de

  2. Gocage

    Considero que no estás bien. Estoy seguro. Lo sugiero que debatir. Escríbeme en PM, hablaremos.

  3. Ceolbeorht

    Pido disculpas por interferir ... Estoy familiarizado con esta situación. Te invito a una discusión.

  4. Uriah

    Suena bastante seductor

  5. Teran

    Completamente comparto tu opinión. En él, algo es también para mí, parece que es una excelente idea. Estoy de acuerdo contigo.



Escribe un mensaje